ID: 1197723450

View in Genome Browser
Species Human (GRCh38)
Location X:129760353-129760375
Sequence ATGTGTGGCTGCCCGGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197723450_1197723463 23 Left 1197723450 X:129760353-129760375 CCAGAACCCGGGCAGCCACACAT 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1197723463 X:129760399-129760421 GCCTACACACACCCAGGCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 225
1197723450_1197723459 17 Left 1197723450 X:129760353-129760375 CCAGAACCCGGGCAGCCACACAT 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1197723459 X:129760393-129760415 CACCCTGCCTACACACACCCAGG 0: 1
1: 0
2: 0
3: 21
4: 259
1197723450_1197723462 22 Left 1197723450 X:129760353-129760375 CCAGAACCCGGGCAGCCACACAT 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1197723462 X:129760398-129760420 TGCCTACACACACCCAGGCCTGG 0: 1
1: 0
2: 2
3: 26
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197723450 Original CRISPR ATGTGTGGCTGCCCGGGTTC TGG (reversed) Intronic
900561408 1:3308937-3308959 ATGTGTGGGTGCCCTGCCTCTGG + Intronic
900612153 1:3548784-3548806 CTGTGAGGCTGCCCCGGTGCTGG - Intronic
902064740 1:13675252-13675274 ATGTGTGGTTGCCAGGGCTGAGG - Intergenic
902266170 1:15266764-15266786 ATTTGTGGTTGCCAGGGGTCAGG - Intronic
902877900 1:19352016-19352038 CTGTGGGGTTGCCTGGGTTCAGG - Intronic
906249434 1:44300101-44300123 AAGTGTTGCTGCCTTGGTTCTGG - Intronic
906490993 1:46268359-46268381 ATGTGTGGTTGCCAGGGATTAGG - Intronic
908040966 1:60112582-60112604 ATCAATGGCTGCCAGGGTTCGGG - Intergenic
909889220 1:80981898-80981920 ATGTGTGGCTGCACAGGTACAGG + Intergenic
912756304 1:112327305-112327327 ATGGGTGGTTGCCAGAGTTCGGG - Intergenic
912951303 1:114122535-114122557 ACGTGGGGCTGCCTGGGGTCTGG + Intronic
917824048 1:178797864-178797886 ATTTGTGGCTGCCAGGGTTAAGG - Intronic
920442911 1:205993347-205993369 ATGAGTGGCTGTCCGGGCTTGGG + Intronic
922982058 1:229835496-229835518 TTGTGTGGCTGACTGGGTTTCGG + Intergenic
1067011056 10:42714289-42714311 ATGGGTCTCTGCCCAGGTTCTGG - Intergenic
1067312542 10:45127582-45127604 ATGGGTCTCTGCCCAGGTTCTGG + Intergenic
1067669344 10:48305557-48305579 ATGTGGGGCTGGCCTGTTTCTGG - Intergenic
1067758850 10:49027615-49027637 ATCTGTGGTTGCCAGGGGTCGGG - Intronic
1071246098 10:83765530-83765552 ATCGGTGGCTGCCGGGGTTAAGG - Intergenic
1071494407 10:86157886-86157908 AAGTGTGGCTGCCTGAGCTCCGG + Intronic
1076672999 10:132133449-132133471 GTCTGGGGCTGCCCGGGTGCCGG - Exonic
1081680926 11:45001897-45001919 ATCTATGGCTGCCTGGGTTGAGG + Intergenic
1083459013 11:62798739-62798761 ATGTCTGGGTGCCCCGGGTCAGG - Intronic
1084553601 11:69863390-69863412 GTGTGCGGCTGCCTGGGCTCTGG - Intergenic
1086767862 11:90721112-90721134 ATCAGTGGCTGCCAGGGTTTAGG + Intergenic
1088655557 11:111996064-111996086 TTGTGTGGCTCCCCAGGTTCGGG + Intronic
1089046022 11:115503259-115503281 ATGTGTGGCTGCCCGTGTGCCGG - Intronic
1089520119 11:119057468-119057490 ATGCTTTGCTGCCGGGGTTCGGG + Intergenic
1096328364 12:50686626-50686648 ATGTGTGGCTGCCAGTCTTTCGG - Exonic
1099599599 12:84716744-84716766 ATTAGTGGTTGCCAGGGTTCAGG + Intergenic
1101385841 12:104256695-104256717 ATCTCTGCCTCCCCGGGTTCAGG - Intronic
1103603915 12:122072600-122072622 ATGTCTGGCTGCTCAGTTTCTGG - Intergenic
1104304746 12:127599638-127599660 ATATGGTGCTGCCCGGCTTCCGG - Intergenic
1105779673 13:23695547-23695569 CTGCGGGGCTGCCAGGGTTCGGG + Intergenic
1106518284 13:30474022-30474044 ATTAGTGGCTGCCAGGGTTTGGG + Intronic
1108712409 13:53046600-53046622 CTGTGTGGCTGGCCCTGTTCTGG + Intronic
1112167400 13:96934319-96934341 ATGTGTGGCTGCTCCGCTGCAGG + Intergenic
1113573828 13:111380683-111380705 TTGTGAAGCTGCCCTGGTTCAGG + Intergenic
1119557050 14:75561236-75561258 ATGGTTGGCTGCCATGGTTCAGG - Intergenic
1121062805 14:90932042-90932064 ATGTGTAGCTGCACTGGTGCAGG - Intronic
1123028347 14:105439112-105439134 AGGGCTGGCTGCCAGGGTTCGGG - Intronic
1129644744 15:77419859-77419881 CTGGGTGGCGGCGCGGGTTCTGG - Intronic
1132226011 15:100141949-100141971 ATGGGTGGCTGGCGGGGTCCCGG - Intronic
1132459741 16:45894-45916 ATTTGTGGCTGCAAGAGTTCAGG + Intergenic
1137656704 16:50165595-50165617 ATATGTGACTGCCAGGGTTAGGG - Intronic
1141516686 16:84549537-84549559 ATGAGTGGCTGCCGGGGGCCAGG + Intronic
1142266750 16:89067465-89067487 TTATGTGGCTACCCGAGTTCTGG + Intergenic
1142713574 17:1736287-1736309 GGGTCTGCCTGCCCGGGTTCAGG + Intronic
1143289132 17:5815754-5815776 CTCAGTGGCTGCCAGGGTTCTGG + Intronic
1145971890 17:28961011-28961033 ATGTTAGGCTGCCTGGGTTCAGG - Intronic
1146890023 17:36500923-36500945 ATGTGGGCGTGCCCGGGTGCTGG - Exonic
1149489074 17:57068960-57068982 ATTTGTGGCTGCCTGGCTTAAGG + Intergenic
1154142194 18:11833971-11833993 ATGTGAGGCTCCCCGGGGTGCGG + Intronic
1154393883 18:13969484-13969506 ATGAGTGGCTGCCTAGGTTGGGG + Intergenic
1155581141 18:27307966-27307988 ATGTGTGGCTTACTGGGTTAGGG - Intergenic
1156639991 18:39081878-39081900 ATGAGTGGTTGCCAGGGTTTGGG + Intergenic
1158302154 18:56064351-56064373 ATGTGGGGCTTCCCAGGCTCTGG + Intergenic
1158534470 18:58295281-58295303 ATGAGTGGTTGCCAGGGTTTAGG - Intronic
1160628072 18:80226817-80226839 ATTTGTGGCTGCTTGGGGTCTGG - Intronic
1161063667 19:2227421-2227443 AGGTGTGGCCGCCCGGGCTCTGG + Intronic
1161481683 19:4513857-4513879 ATGTCTGGCTGACCGGGGTCGGG - Intronic
1163272939 19:16265142-16265164 ATTTGTGGTTGTCAGGGTTCTGG - Intergenic
1163348622 19:16761030-16761052 ATGAGTGGCTGCCAGGGGTTAGG - Intronic
1163591334 19:18195753-18195775 AAGCTTCGCTGCCCGGGTTCAGG - Intronic
1167588379 19:50388145-50388167 ATGAGTGGCTGCCAGGGGTGGGG + Intronic
1168319337 19:55499928-55499950 AAGTGTGACTGCCAGTGTTCTGG + Exonic
925999600 2:9319552-9319574 ATGTCAGGCTGCCAGGGTGCAGG + Intronic
927121258 2:19965540-19965562 ATGCTTGGCTGCCAGTGTTCTGG + Intronic
929456372 2:42068981-42069003 ATGTGCTGCTGCCTGGGCTCTGG - Intergenic
929998193 2:46842728-46842750 ATGTCTGTCTGCCCTTGTTCTGG + Intronic
932355067 2:71061636-71061658 ATTAGTTGCTGCCAGGGTTCAGG + Intergenic
932607272 2:73173822-73173844 ATGTGTGGAAGCCAAGGTTCTGG - Intergenic
937349118 2:121149099-121149121 ATTTGTGGCTGCCAGGGGTCAGG + Intergenic
938109151 2:128552591-128552613 ATGTGTGGCTGGCCTGGCTTGGG + Intergenic
939638441 2:144610972-144610994 ATGTGGGGCTGCCCAGCCTCTGG + Intergenic
943198766 2:184791837-184791859 ATCAGTGGCTGCCAGGGTTTGGG - Intronic
944079631 2:195772154-195772176 ATGCTTGGCTGCCAGGGTACAGG + Intronic
945144542 2:206723636-206723658 AGGAGTGGCTGCCCAGGTTCTGG - Intergenic
1168753253 20:298198-298220 ATTCGCGGCTGCCCGGGATCTGG - Exonic
1172767413 20:37358277-37358299 ATGTGTGTGGGCCCGGGCTCTGG + Intronic
1173304552 20:41835814-41835836 CTGTGTTGCTGCCCAGCTTCAGG - Intergenic
1173577574 20:44123083-44123105 CTGTGTGGCCGCCCCTGTTCTGG - Intronic
1175885228 20:62286542-62286564 CTGTGTGGCTGCCCGGGGCCAGG - Intronic
1176081951 20:63277948-63277970 CTGAGTGGCTGCTCGGGCTCAGG - Intronic
1176985653 21:15432613-15432635 AAGTGGGACTGCCTGGGTTCTGG + Intergenic
1178980974 21:37265105-37265127 ATTTGTGACTGCCAGGGGTCAGG + Intronic
1181982519 22:26775551-26775573 AGGTGTGGTTGCTCGGGTTTTGG - Intergenic
1185252392 22:49811220-49811242 ATGGGTGGCTGCCAGGGCTGGGG + Intronic
955718873 3:61860976-61860998 ATTAGTGGTTGCCCGGGTTGGGG - Intronic
957725218 3:84055785-84055807 ATATGTGGCTGCCAGGGGTTAGG - Intergenic
958534853 3:95387403-95387425 ATGTGTGGCTGCCCCAGGGCTGG + Intergenic
961391297 3:126553689-126553711 ATCAGTGGCTGCCAGGGTTGGGG - Intronic
961406395 3:126682628-126682650 TTCTGTGGCTGGCCGGGTCCAGG + Intergenic
962270849 3:133977031-133977053 AGGTGAGGCTGCCCGGGTGGTGG - Intronic
966600255 3:181767987-181768009 ATCTCTGGCTGCCTGTGTTCAGG - Intergenic
966719857 3:183051490-183051512 ATGAGTGGCTGCCGGGGTTTAGG + Intronic
966816531 3:183894399-183894421 ATAAGTGGCTGCCAGGATTCGGG - Intergenic
967020133 3:185515455-185515477 ATGTGTGGCAGCCCAGGATTTGG - Intronic
970881977 4:20943246-20943268 ATGTGTGGCTGCCAGGATAGTGG + Intronic
975859204 4:78658350-78658372 ATTTATGGTTGCCAGGGTTCAGG - Intergenic
980332011 4:131422614-131422636 TTGTGTCTCTGCCCGGCTTCAGG - Intergenic
986941098 5:12950970-12950992 ATCTGTGGCTGCCCATGTCCTGG - Intergenic
986966175 5:13274573-13274595 TTGTGTGGCTGCCCGGTGGCTGG - Intergenic
989500351 5:42159194-42159216 AAGTGATGGTGCCCGGGTTCTGG - Intergenic
990007504 5:50960926-50960948 AAATCTGGCTGCCCAGGTTCAGG + Intergenic
995888886 5:116927263-116927285 ATCTGTGGTTGCCAGGGTTTAGG - Intergenic
997624419 5:135321932-135321954 ATGTGTGGATCCATGGGTTCTGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998453448 5:142252195-142252217 AAGTGTGGCAGCCCGGGGTGTGG + Intergenic
1000881151 5:166699074-166699096 ATGGCTGGCTGCCAGCGTTCTGG + Intergenic
1002566873 5:180117087-180117109 CTGTCTGGCTTCCCGGGCTCCGG + Intronic
1002789634 6:427710-427732 ATGTGGGGCAGCCCCGGTGCGGG - Intergenic
1005595343 6:27374038-27374060 ATCAGTGGCTGCCAGGGTTAAGG + Intergenic
1005627094 6:27672921-27672943 ATGTTTAGCTGCCCTGGTTGTGG - Intergenic
1006507289 6:34497580-34497602 AGGTGTGGCTGCCTGGGGGCAGG - Intronic
1010995103 6:82523697-82523719 ATGTGTGGCTGCCAGGGTCTTGG - Intergenic
1017605990 6:156133736-156133758 ATCAGTGGCTGCCAGGGGTCAGG - Intergenic
1018472114 6:164106465-164106487 CTGTGTGGCTGCCCTGCATCGGG + Intergenic
1019591490 7:1837760-1837782 ATCAGTGGCTGCCTGGGGTCGGG + Intronic
1021810007 7:24394018-24394040 ATCAGTGGCTGCCAGGGATCAGG + Intergenic
1024294135 7:47829511-47829533 ATGTGAGGCTACCAGGGATCTGG - Exonic
1028862781 7:95672376-95672398 ATTTGTTTCTGCCAGGGTTCTGG + Intergenic
1029032421 7:97482870-97482892 ATGATTGGCTGCCAGTGTTCTGG - Intergenic
1033669371 7:143476579-143476601 ATTGGTGGTTGCCAGGGTTCTGG + Intergenic
1034563032 7:151893906-151893928 ATGTGAGGCAGGCGGGGTTCTGG - Intergenic
1036453354 8:8888682-8888704 ATCTGTGGTTGCCGGGGTTGGGG + Intronic
1037776540 8:21839276-21839298 AGGTGTGGCTGCCCCGGTCAGGG - Intergenic
1039415885 8:37393742-37393764 ATGTGTGGCTGCCTCGCTTTGGG - Intergenic
1039874274 8:41572386-41572408 ATGTGTGGCTCCCAGGGCTCTGG - Intergenic
1042866101 8:73357850-73357872 ATGAGTGGCTGCCATGGGTCAGG + Intergenic
1043717905 8:83508636-83508658 ATGCCTGGCTGCTCCGGTTCAGG + Intergenic
1047225507 8:122952756-122952778 ATGTGTGGACGCTTGGGTTCGGG - Exonic
1048698247 8:137053466-137053488 ATCAGTGGTTGCCCGGGTTTTGG - Intergenic
1050189758 9:3012450-3012472 TGGTGTGGCTGCCAGGGTTGAGG - Intergenic
1050617237 9:7414474-7414496 CTGTGTGGCTGGCCGTCTTCAGG + Intergenic
1056402891 9:86245422-86245444 AATGGTGGCTGCCAGGGTTCGGG - Intronic
1057508414 9:95656230-95656252 ATCTGTGGTTGCCAGGGTTTAGG - Intergenic
1059497275 9:114720187-114720209 TGGTGAGGCTGCCAGGGTTCGGG + Intergenic
1060390018 9:123269076-123269098 TTGTGTGGCTGCTGGGGTTGGGG - Intergenic
1062515167 9:136929815-136929837 GTGTGTGGCTGCCACGGGTCGGG - Intronic
1062592349 9:137280057-137280079 ATTTGTGGCTGCCCGGCTGGTGG + Exonic
1188205728 X:27355293-27355315 ATTTGTGGCTGCCAGAATTCAGG + Intergenic
1189290186 X:39879383-39879405 CTGTCTGGCTGCCTGGATTCTGG + Intergenic
1190059674 X:47202742-47202764 ATATGTGGCTGCTGGGGATCTGG + Exonic
1193883783 X:86960234-86960256 CTGTGTGGCTGCCCAGGGTGGGG + Intergenic
1196761715 X:119206674-119206696 ATTAGTGGTTGCCCGGGTCCAGG + Intergenic
1197723450 X:129760353-129760375 ATGTGTGGCTGCCCGGGTTCTGG - Intronic
1199861892 X:151808520-151808542 TTGTGTGGCTGCTGGGGTTGAGG + Intergenic