ID: 1197724196

View in Genome Browser
Species Human (GRCh38)
Location X:129765510-129765532
Sequence TAGTGAGTATGTGAGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2472
Summary {0: 1, 1: 0, 2: 19, 3: 234, 4: 2218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197724196_1197724199 21 Left 1197724196 X:129765510-129765532 CCCATTTCCTCACATACTCACTA 0: 1
1: 0
2: 19
3: 234
4: 2218
Right 1197724199 X:129765554-129765576 ACTAATTTTTCCAATCTGATAGG 0: 1
1: 0
2: 3
3: 28
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197724196 Original CRISPR TAGTGAGTATGTGAGGAAAT GGG (reversed) Intronic
Too many off-targets to display for this crispr