ID: 1197724196 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:129765510-129765532 |
Sequence | TAGTGAGTATGTGAGGAAAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2472 | |||
Summary | {0: 1, 1: 0, 2: 19, 3: 234, 4: 2218} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1197724196_1197724199 | 21 | Left | 1197724196 | X:129765510-129765532 | CCCATTTCCTCACATACTCACTA | 0: 1 1: 0 2: 19 3: 234 4: 2218 |
||
Right | 1197724199 | X:129765554-129765576 | ACTAATTTTTCCAATCTGATAGG | 0: 1 1: 0 2: 3 3: 28 4: 265 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1197724196 | Original CRISPR | TAGTGAGTATGTGAGGAAAT GGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |