ID: 1197727758

View in Genome Browser
Species Human (GRCh38)
Location X:129787776-129787798
Sequence TCCATTCTTCACCCCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197727758_1197727761 8 Left 1197727758 X:129787776-129787798 CCAGGGCTGGGGTGAAGAATGGA 0: 1
1: 0
2: 7
3: 32
4: 350
Right 1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1197727758_1197727766 29 Left 1197727758 X:129787776-129787798 CCAGGGCTGGGGTGAAGAATGGA 0: 1
1: 0
2: 7
3: 32
4: 350
Right 1197727766 X:129787828-129787850 GGTGCGTCACCCATTAGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1197727758_1197727767 30 Left 1197727758 X:129787776-129787798 CCAGGGCTGGGGTGAAGAATGGA 0: 1
1: 0
2: 7
3: 32
4: 350
Right 1197727767 X:129787829-129787851 GTGCGTCACCCATTAGCCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1197727758_1197727765 28 Left 1197727758 X:129787776-129787798 CCAGGGCTGGGGTGAAGAATGGA 0: 1
1: 0
2: 7
3: 32
4: 350
Right 1197727765 X:129787827-129787849 AGGTGCGTCACCCATTAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197727758 Original CRISPR TCCATTCTTCACCCCAGCCC TGG (reversed) Intronic