ID: 1197727761

View in Genome Browser
Species Human (GRCh38)
Location X:129787807-129787829
Sequence AGGTAGCCCCAAGAACATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197727758_1197727761 8 Left 1197727758 X:129787776-129787798 CCAGGGCTGGGGTGAAGAATGGA 0: 1
1: 0
2: 7
3: 32
4: 350
Right 1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197727761 Original CRISPR AGGTAGCCCCAAGAACATCG AGG Intronic