ID: 1197727761

View in Genome Browser
Species Human (GRCh38)
Location X:129787807-129787829
Sequence AGGTAGCCCCAAGAACATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197727758_1197727761 8 Left 1197727758 X:129787776-129787798 CCAGGGCTGGGGTGAAGAATGGA 0: 1
1: 0
2: 7
3: 32
4: 350
Right 1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197727761 Original CRISPR AGGTAGCCCCAAGAACATCG AGG Intronic
904676949 1:32204521-32204543 AGATAGCCCCCAGAGCATTGGGG + Intronic
1063242036 10:4180466-4180488 AGGATGCCCCAAGAACAAAGGGG - Intergenic
1064553215 10:16522412-16522434 ATGTTGCCCCAAGAACAGTGAGG + Intergenic
1066521772 10:36228267-36228289 GGGTAGTCCCAAGAAAATTGGGG - Intergenic
1070579094 10:77705244-77705266 AGGGAGGCCCAAGGACATCCAGG - Intergenic
1071147015 10:82587586-82587608 AGGTAGGCCCAACATCATCCAGG + Intronic
1076784963 10:132745236-132745258 AGGTGTCCCCAGGAGCATCGTGG - Intronic
1080780423 11:35424048-35424070 AGGTAGCCCCCATAACATGTGGG + Intergenic
1083924055 11:65795367-65795389 TGGAAGCCCCAAGAGCATCCAGG + Exonic
1085416798 11:76323920-76323942 TGGTGGCCCCAAGAATAACGGGG - Intergenic
1087727804 11:101741998-101742020 AGGGAGCCCCAAGGCCAACGTGG - Intronic
1090248647 11:125235972-125235994 AGGTAGCCCCATAAGCAGCGTGG - Intronic
1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG + Intronic
1092319197 12:7453290-7453312 AGGTACACCCAAGTAGATCGAGG + Intronic
1095637704 12:44452291-44452313 CGGAAGCCCCTAGACCATCGTGG + Intergenic
1096476705 12:51913218-51913240 AGGCACCCCCAGGAACATCGGGG + Exonic
1100400318 12:94223730-94223752 AGTTGACCCCAAGAAGATCGTGG + Intronic
1111311865 13:86499982-86500004 AGGTTGCCCCAAGAAAATTTGGG - Intergenic
1111746178 13:92272363-92272385 ATGTAGCCCCAAGTACCTCATGG - Intronic
1127489361 15:59447818-59447840 AGGTAGCCTCAAGACCATGGAGG + Intronic
1130109424 15:80952376-80952398 AGGTAGCCCCATGAAGCTAGTGG - Intronic
1137831427 16:51546891-51546913 ATGTAGCCCCCAGTACATCAGGG + Intergenic
1143734047 17:8897866-8897888 TGGTGGCCCCATGAACATCCTGG - Intronic
1145778094 17:27543440-27543462 AGGGATCCCCAGGAACATGGAGG - Intronic
1147924537 17:43938487-43938509 AGGCACCCCCACGCACATCGCGG + Intronic
1150699860 17:67437353-67437375 AGATAGCCCCTTGAACATGGAGG + Intronic
1153933824 18:9902802-9902824 TGGTAGCCCCAAAGACATCAGGG + Intergenic
1162940827 19:14007970-14007992 AGGTAGGCCCTAGAACAGCAAGG + Intergenic
929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG + Intronic
931409226 2:62012936-62012958 AGGCAGCCCCAGGAAGATCTGGG + Intronic
938945975 2:136212420-136212442 AGGAGTCCCCAAGAACATCCTGG - Intergenic
939404340 2:141736553-141736575 TGGTAGCCCCAAGCACACCTTGG - Intronic
940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG + Intronic
941911623 2:170770509-170770531 AGGTCGCCCCAAGAAGATTATGG - Intergenic
949006944 2:241655123-241655145 AGGATGCCCCAACAAGATCGGGG - Intronic
1170598237 20:17821474-17821496 AGGTATACCAAAGAACATCGAGG + Intergenic
1174429404 20:50456767-50456789 TGATAGCCCCAAGACCATCCAGG - Intergenic
1174774698 20:53333003-53333025 AGGCAGCCCCAGGAAGATCTGGG - Intronic
1182461218 22:30485425-30485447 AGGTGGCCCCACGAACAGCCTGG + Intergenic
951819889 3:26796429-26796451 AAGAAGCCCCAAGGACATGGAGG + Intergenic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
954653982 3:52182685-52182707 AGGTTGCCCCACCAACATCTGGG + Intergenic
957140472 3:76348566-76348588 AATTACCCCCAAGAACATCATGG + Intronic
961521257 3:127468581-127468603 AGGTAGCCACAGGAATATGGAGG + Intergenic
963270356 3:143280156-143280178 AGGTGGCCTCAAGAACACCCAGG - Intronic
964031124 3:152139956-152139978 AGGTAGGCCAAAGAACAATGTGG + Intergenic
964746207 3:160014931-160014953 AGGTTCCCCCAAGAACAACAGGG - Intergenic
966687174 3:182708766-182708788 AGGTAGCTCCAGGAACTTCAGGG - Intergenic
968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG + Intronic
976024184 4:80666932-80666954 ATGTAGCCTGAAGAAAATCGAGG - Intronic
978936955 4:114389281-114389303 AGGTAGCTCAAAGAACACCTGGG + Intergenic
985096755 4:186420502-186420524 AGGCAGCCCCATGACCATCGGGG - Intergenic
991086600 5:62653470-62653492 AGGAATCCCTAAGAACATAGAGG + Intergenic
998007027 5:138663806-138663828 AAGCAGTCACAAGAACATCGGGG + Intronic
998227381 5:140337454-140337476 AGGAAGCACCAAGAACCTGGTGG + Intronic
1000217582 5:159177501-159177523 AGGTAGTCCTAAGAACACCCTGG + Intronic
1001658109 5:173369562-173369584 AGGTCACCCCAAGAAAATCAGGG - Intergenic
1009023222 6:57967873-57967895 AGGGCCCCTCAAGAACATCGTGG - Intergenic
1016351604 6:143175309-143175331 AAGTAGCTCAAAGAACATCTGGG - Intronic
1021209299 7:17825732-17825754 AGCTAGACCCAAGAACAAAGAGG + Intronic
1027691563 7:81353377-81353399 AAGAAGCCCGAAGAACATCTGGG - Intergenic
1032080743 7:128857287-128857309 CGGTGGCCCCCAGCACATCGTGG + Exonic
1032091511 7:128913873-128913895 CGGTGGCCCCCAGCACATCGTGG - Intergenic
1032382961 7:131503388-131503410 TGGAAGCCCAAAGAAGATCGTGG + Intronic
1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG + Intergenic
1035605474 8:927388-927410 AGGTAGACCCAAGAGCCTTGGGG - Intergenic
1037773481 8:21817236-21817258 AGGTAGCACCTTGAACAGCGTGG - Intergenic
1039247517 8:35625315-35625337 AGATATCCACCAGAACATCGAGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1050987856 9:12105487-12105509 AAGAAGCCCAAAGAACATCTGGG + Intergenic
1051929613 9:22368623-22368645 AGGTAGCTCAAAGAACACCTGGG + Intergenic
1061302078 9:129711133-129711155 AGCCAGCCCCAAGATCCTCGTGG - Intronic
1194322987 X:92475677-92475699 AAGAAGCCCAAAGAACATCAAGG - Intronic
1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG + Intronic
1198035181 X:132794900-132794922 AGGTGGCCCCCAGTACTTCGGGG - Intronic
1200631087 Y:5588837-5588859 AAGAAGCCCAAAGAACATCAAGG - Intronic