ID: 1197728867

View in Genome Browser
Species Human (GRCh38)
Location X:129793940-129793962
Sequence CTAAGTGTCCCTGGGGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197728867_1197728876 -1 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728876 X:129793962-129793984 GGGCCACAGAGGCCAGGCCAGGG 0: 1
1: 1
2: 8
3: 85
4: 716
1197728867_1197728880 15 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728880 X:129793978-129794000 GCCAGGGCCCTACAGGTTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 182
1197728867_1197728884 24 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728884 X:129793987-129794009 CTACAGGTTCCAGGCTCAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 135
1197728867_1197728878 8 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728878 X:129793971-129793993 AGGCCAGGCCAGGGCCCTACAGG 0: 1
1: 0
2: 1
3: 38
4: 339
1197728867_1197728875 -2 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728875 X:129793961-129793983 AGGGCCACAGAGGCCAGGCCAGG 0: 1
1: 0
2: 9
3: 107
4: 810
1197728867_1197728874 -7 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728874 X:129793956-129793978 CACTTAGGGCCACAGAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 281
1197728867_1197728885 29 Left 1197728867 X:129793940-129793962 CCTGCTTCCCCAGGGACACTTAG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1197728885 X:129793992-129794014 GGTTCCAGGCTCAGCTGGAGTGG 0: 1
1: 0
2: 4
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197728867 Original CRISPR CTAAGTGTCCCTGGGGAAGC AGG (reversed) Exonic
901153772 1:7122098-7122120 GTGAGTGTCCGAGGGGAAGCTGG + Intronic
902331007 1:15731258-15731280 GTAAGTGTCCCGGGAGAAGCGGG + Intronic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903855792 1:26336980-26337002 CTGACTGTCCCTGGGGACCCAGG - Exonic
903856353 1:26339793-26339815 CTAAATGGACTTGGGGAAGCGGG - Intronic
904252119 1:29232545-29232567 CTATGTGTCACTGGGGAAAAGGG - Intergenic
904284556 1:29445572-29445594 CTCAGCATCCCTGGGGAACCTGG + Intergenic
904368962 1:30036409-30036431 CTCAGCATCCCTGGGGAACCTGG + Intergenic
904401520 1:30259814-30259836 CCAGGTCGCCCTGGGGAAGCCGG + Intergenic
904597575 1:31656488-31656510 CTGAGGCTCCCTGGGGAGGCAGG + Intronic
905038332 1:34931014-34931036 CTAGGTATCCCTTGGGAAGAGGG - Intergenic
905794634 1:40808644-40808666 CTTCCTGTCCCTGTGGAAGCTGG + Intronic
906709751 1:47920457-47920479 CAAGGTGGCCCTGGGGAGGCTGG + Intronic
906712588 1:47942186-47942208 CTTGGTGTCCCTGGTGAACCAGG - Intronic
907495736 1:54843105-54843127 CTAACAATCCCTGGGGAAGGAGG - Intergenic
912519915 1:110238216-110238238 CTAGGGATCCCTGGAGAAGCAGG - Intronic
913470684 1:119182561-119182583 TTCAATTTCCCTGGGGAAGCCGG - Intergenic
918015737 1:180631303-180631325 TGAAGTGTCCCTGGGGAACATGG - Intergenic
918627656 1:186676417-186676439 CTAATTTTCCCTGGGGAAGAGGG + Intronic
919767461 1:201136454-201136476 CTTAGTTTCCCTGGGAAAGAGGG + Intronic
923771632 1:236942589-236942611 CTAAGGTTCCCTGAGGAAGAAGG - Intergenic
924942405 1:248821232-248821254 CCAGGAGTCCCTGGTGAAGCAGG - Intronic
1063753221 10:8975995-8976017 CACAGTCTCCCAGGGGAAGCTGG - Intergenic
1064429782 10:15260863-15260885 CTAAATGTCTCTGGGGAGGGGGG + Intronic
1065475387 10:26131522-26131544 GTAACTGTCCATGGGAAAGCAGG - Intronic
1067470772 10:46536229-46536251 CTAAGCTTCCCTGGGGAATTGGG - Intergenic
1067959266 10:50829582-50829604 ATAACTGACCCTGGAGAAGCTGG + Intronic
1071291246 10:84190810-84190832 CTCAGTGTGCCTGGGGAGCCTGG - Intergenic
1071858715 10:89650979-89651001 GTAAAACTCCCTGGGGAAGCGGG + Intergenic
1072237493 10:93465981-93466003 CTGAGTTTCCCTGGGGCAGCTGG + Intronic
1072385791 10:94926376-94926398 AAAAGTGCCCCTGGGAAAGCTGG - Intergenic
1073972301 10:109058648-109058670 CTGGGTGTGGCTGGGGAAGCTGG + Intergenic
1075535308 10:123266662-123266684 CTAAGTGCCCCTCAGGAAGGGGG - Intergenic
1075616181 10:123892017-123892039 ATTAGCGTCTCTGGGGAAGCAGG - Intronic
1076836801 10:133025273-133025295 CTAAGGCTCCCTGGAGAGGCTGG + Intergenic
1077503027 11:2917740-2917762 CTAAGTGCCTCTGGGGATTCAGG + Intronic
1080197478 11:29629417-29629439 TTGAGTGACTCTGGGGAAGCTGG + Intergenic
1083599780 11:63939416-63939438 ATGAGTGACCCTGGGGGAGCGGG - Intronic
1084784638 11:71435114-71435136 ATCAGTGTCCCTGGGGCAGGAGG - Exonic
1089864136 11:121616956-121616978 CAAAGTGGGCATGGGGAAGCAGG + Intronic
1090898822 11:131006604-131006626 CCAAATGTCCCTGGGGTAGGTGG + Intergenic
1092243304 12:6848959-6848981 CTCAGTATCCCTGGGAAAGAAGG + Exonic
1095987396 12:48008538-48008560 CTGAGTGTCACTGAGTAAGCTGG - Intergenic
1098350884 12:69558637-69558659 AAAAGTCTCCCTGGGAAAGCTGG - Intronic
1101726743 12:107394257-107394279 CTCTGTGACCCTGGGTAAGCTGG - Intronic
1102422706 12:112816595-112816617 CTCCCTTTCCCTGGGGAAGCTGG - Intronic
1103845818 12:123901395-123901417 CTACTTGTCCCTGGGGCAGCAGG - Intronic
1103925848 12:124423036-124423058 CTGAGTGCCCGTGGGGCAGCAGG + Intronic
1103935682 12:124475260-124475282 CTAGGTGTCCCTGGGGGAGGTGG - Intronic
1104019770 12:124984122-124984144 CCAAATGTCCCTGGGGCAGCGGG + Intronic
1104882395 12:132081557-132081579 CCAAGTGTGCCTGTGGCAGCAGG + Intergenic
1106120026 13:26852419-26852441 CTGAGTGTCCCAGGGGCTGCTGG + Intergenic
1107556581 13:41520968-41520990 CAAGCAGTCCCTGGGGAAGCGGG + Intergenic
1111495218 13:89039235-89039257 CTAAGTGTTTATGTGGAAGCTGG + Intergenic
1111589424 13:90324383-90324405 CTAGGCCTCCCTGGGGAAGTTGG - Intergenic
1111776013 13:92662785-92662807 CAAAGTTTCCCTGTGGAATCAGG + Intronic
1113279707 13:108776169-108776191 GTAAGTGTCCTTAGGAAAGCTGG - Intronic
1113636464 13:111922269-111922291 CTCTGTGTCCCTGGGGGAGCTGG - Intergenic
1115691301 14:35846744-35846766 GTAAGTTTACCTGGGGAAACTGG - Intronic
1119395892 14:74326299-74326321 GGAAGTGGTCCTGGGGAAGCAGG + Intronic
1121098856 14:91235977-91235999 CCAAGTCTCCCTGGGAGAGCAGG - Intronic
1121259072 14:92553233-92553255 CTAACTGGCCCGGGGGAGGCTGG + Intronic
1121372599 14:93374163-93374185 CTAAGTGGAACTGTGGAAGCAGG + Intronic
1122116953 14:99532463-99532485 GTATGTGGCCCTGGGGATGCAGG - Intronic
1122869979 14:104634045-104634067 GTTAGTGGCTCTGGGGAAGCTGG + Intergenic
1123629307 15:22250124-22250146 CCATGTGTTCCTGTGGAAGCTGG - Intergenic
1124018944 15:25902690-25902712 CAAAGTGTCCCTTGAGCAGCTGG + Intergenic
1125504067 15:40256910-40256932 CTCACTGTGCCTGGAGAAGCTGG + Intronic
1128236877 15:66073629-66073651 CTGTGTCTCCCTGGGGAACCAGG - Intronic
1128708637 15:69855778-69855800 CTGGGTCTCCCTGGGGAACCAGG - Intergenic
1130784158 15:87077325-87077347 CTAAATGTCCCTGGGAAGTCTGG + Intergenic
1130891699 15:88138938-88138960 CTGACTGTCCCTGGGGGAGTAGG + Intronic
1132027821 15:98417892-98417914 CTGGGTGTCCCTGGGGAGGATGG - Intergenic
1132470478 16:100088-100110 CTGAGTGTCCTTGGGGAGGCCGG - Intronic
1133255662 16:4514285-4514307 CTAGGTGGCCCTGGGAAAGGTGG - Intronic
1133742935 16:8664968-8664990 CTGAGGGTCCCTGGGGAGGAGGG + Intergenic
1141158969 16:81616686-81616708 CCAAGTGTGGCTGGGGAAGGGGG + Intronic
1141873500 16:86805939-86805961 CTAAGTGGAGCTGGGCAAGCGGG - Intergenic
1142142021 16:88476677-88476699 CCAAGTGTGGCTGGGGAGGCAGG + Intronic
1142473353 17:175765-175787 CTGGGTGTCCCAGGGGGAGCAGG - Intronic
1142693691 17:1621756-1621778 ATGGGGGTCCCTGGGGAAGCTGG + Intronic
1143396247 17:6600265-6600287 CTAAGTGTCTCTGTGGCATCTGG - Intronic
1143622003 17:8086122-8086144 CCAAGGGTCCTTGGGGAAGAAGG + Exonic
1144247104 17:13377781-13377803 CTCAGTGTTCCTGAGGAAGCTGG - Intergenic
1144341874 17:14316801-14316823 TTAGGTGTCACTGGGGAAGGAGG + Intronic
1144598217 17:16589292-16589314 AAAAATGTCCCTGGAGAAGCCGG + Intergenic
1145243405 17:21252663-21252685 CTAAGATTCCCAGGGGCAGCAGG + Intronic
1146289610 17:31598170-31598192 CTCACTGACCCTGAGGAAGCTGG + Intergenic
1146408750 17:32564054-32564076 CTAATTGTCCATGGGCAGGCTGG - Intronic
1147480986 17:40762489-40762511 CTCTGGGTCCCTGTGGAAGCAGG + Intergenic
1147627243 17:41908089-41908111 CTAAATGGCCCTGGGGGAGGAGG - Intronic
1148866543 17:50631717-50631739 GTGAGTGTCCCAGGGGAACCCGG - Intergenic
1150652263 17:67017842-67017864 CTAAGAGTCCCTTGGGTAGAGGG + Intronic
1151477468 17:74352259-74352281 CGAAGTGTACCTGCGGGAGCTGG + Exonic
1155149977 18:23115424-23115446 CTCAGTGTCCCTGTGAAAGAGGG - Intergenic
1157948251 18:52005165-52005187 CCAAATGTCCCTTGGGAAGAGGG - Intergenic
1158283563 18:55853524-55853546 CTAAATGTCCCTGGGGTTGTGGG + Intergenic
1159943842 18:74428999-74429021 CCAGTTGTCCCTGGGCAAGCTGG - Intergenic
1160363391 18:78303593-78303615 CAAAGTCTCCATGAGGAAGCGGG + Intergenic
1161684463 19:5696065-5696087 CTACGTGGCCCAGGAGAAGCTGG - Exonic
1161706919 19:5826547-5826569 CTGGGTGGCCCTGGGGAAGGAGG - Intronic
1161708319 19:5832809-5832831 GCAAGGGTCCCTGGGGAAGTTGG + Intronic
1162719904 19:12656210-12656232 ATAAATTTTCCTGGGGAAGCGGG + Intronic
1163469022 19:17486293-17486315 CTTGGTGGCCCTGGGGGAGCTGG - Intronic
1163605303 19:18271733-18271755 CTAAGTGTTGCTGGGGCAGGAGG + Intronic
1163677598 19:18663096-18663118 CTTTGAGTCCCTGGGGAAGCAGG - Intronic
925097458 2:1218701-1218723 GGATGTGCCCCTGGGGAAGCAGG + Intronic
925453417 2:3991103-3991125 CTAAGTGTTCAAGAGGAAGCAGG - Intergenic
926686742 2:15704091-15704113 CCCAGCCTCCCTGGGGAAGCTGG - Intronic
927887378 2:26727029-26727051 TTCAGTCTCCCTGGGGCAGCTGG - Intronic
928698454 2:33874121-33874143 CTAGGTTTCCCTAGGAAAGCGGG - Intergenic
928702416 2:33912449-33912471 TTATGGGTCACTGGGGAAGCAGG - Intergenic
929236353 2:39609226-39609248 CAAGGTTTCTCTGGGGAAGCAGG - Intergenic
929778537 2:44943155-44943177 CTAAGTCTCCCAGGGGCTGCGGG - Intronic
930609887 2:53530325-53530347 TCTGGTGTCCCTGGGGAAGCTGG - Intergenic
932655777 2:73610178-73610200 CAGAGAGTCCCTGGGGGAGCTGG - Intronic
934615378 2:95767599-95767621 CTAACTGTGCCTGGTGAATCTGG + Intergenic
934645525 2:96056959-96056981 CTAACTGTGCCTGGAGAATCTGG - Intergenic
934660927 2:96143388-96143410 CCCTGTGTTCCTGGGGAAGCTGG - Exonic
934838929 2:97613048-97613070 CTAACTGTGCCTGGAGAATCTGG - Intergenic
936071369 2:109373964-109373986 CTGAGTGTGCCTGTGGAACCAGG - Intronic
936501654 2:113071709-113071731 CTGAGGGACCCTGGGGAGGCAGG - Intronic
938110358 2:128560158-128560180 CTCTGTGTCCTTGGTGAAGCAGG + Intergenic
938290141 2:130144696-130144718 TTGAGTGTGCCTGGGGAGGCAGG + Intronic
938466388 2:131528249-131528271 TTGAGTGTGCCTGGGGAGGCAGG - Intronic
939793241 2:146607147-146607169 ATAAATGTCGCTGGGGAAACTGG - Intergenic
944290635 2:198000460-198000482 CTAAATTTCCCTGGGAAAGAAGG - Intronic
946445557 2:219737189-219737211 CTTGGGGTCCCTGGGGAAGTGGG + Intergenic
947147594 2:227082498-227082520 GTATGTATCACTGGGGAAGCTGG + Intronic
948421138 2:237860644-237860666 CCCAGTGTCCCTGGGAAGGCCGG + Intronic
948978577 2:241480138-241480160 CACAGTGCCCCTTGGGAAGCTGG - Intronic
1174907858 20:54571616-54571638 CCAAGTATCTCTGGGGAAGGGGG + Intronic
1175484834 20:59338378-59338400 CTATGTGCACCTGGGGATGCTGG + Intergenic
1175488013 20:59359253-59359275 CTATGTGCACCTGGGGATGCTGG - Intergenic
1175987475 20:62771163-62771185 CTCGCTGTCCCTGGGGAGGCGGG - Intergenic
1176386946 21:6142881-6142903 CAAAGAGTCCCTGGTGCAGCGGG - Intergenic
1178891296 21:36523051-36523073 GTGAGTGTCCCTGGGGAGGTGGG - Intronic
1179597481 21:42452496-42452518 CCAAATGTCCCTGGGGGAGCAGG + Intergenic
1179736527 21:43395371-43395393 CAAAGAGTCCCTGGTGCAGCGGG + Intergenic
1180019996 21:45117201-45117223 CTAGGTCTCCCTGGAGAAGGAGG - Intronic
1183138528 22:35914166-35914188 TTAAGTGACCTTGGGCAAGCTGG + Intronic
1183176878 22:36230832-36230854 ATATGTGTTCCTGGGGATGCTGG - Intronic
1183931242 22:41237376-41237398 CGAAGTGTCCCTTGGGGCGCTGG - Exonic
1183975948 22:41512476-41512498 CTAGGTGTCCCTGGGCAAGAAGG - Intronic
1184217458 22:43077195-43077217 TGAGGTGTACCTGGGGAAGCAGG - Intronic
1184770911 22:46595885-46595907 CTCAGCCTCCCTGGGTAAGCTGG - Intronic
1185387896 22:50544752-50544774 CTAATAGTCCCAGGGGGAGCTGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950611603 3:14130623-14130645 AGAAGTCTCCCTGGGAAAGCAGG + Intronic
950634196 3:14303543-14303565 ACAATTGTCCCTGGGGTAGCAGG - Intergenic
953349962 3:42208030-42208052 CCAAATGTCCCTGGGGGAGTGGG + Intronic
953409358 3:42681231-42681253 GTCTGTGTTCCTGGGGAAGCTGG + Intergenic
954226837 3:49187392-49187414 CTAAGGGCCCCTGTGGAGGCTGG + Intronic
954283624 3:49602247-49602269 CTCTGTGTCCCTGGGGCAGCAGG + Intronic
954907793 3:54077490-54077512 CAATGTGTCCCTGAGGAAACAGG - Intergenic
957228323 3:77477487-77477509 CTGGGTGTCCCCGGGGAGGCTGG - Exonic
958068590 3:88579091-88579113 AAAACTGCCCCTGGGGAAGCTGG + Intergenic
960360253 3:116702496-116702518 CTAACTGTCTCTGGGGATGCTGG - Intronic
962042880 3:131725484-131725506 CTGGGTCTTCCTGGGGAAGCTGG - Intronic
962103214 3:132364229-132364251 CTCAGCCTCCCGGGGGAAGCTGG - Intronic
962369999 3:134813412-134813434 ATACCTGTCCCTGGAGAAGCAGG - Intronic
964808120 3:160633716-160633738 CTCAGTGTGTCTGGGTAAGCTGG + Intergenic
966427626 3:179796827-179796849 CTAAATGTCCCTTGAGAAACTGG - Exonic
968360836 3:198145588-198145610 CTGAGGGTCGCTGGGGATGCTGG - Intergenic
968596945 4:1490657-1490679 ATCAGTGACCCTGAGGAAGCAGG - Intergenic
968812018 4:2804448-2804470 CCAAGAGCCCCTGGGGAGGCTGG - Intronic
969511220 4:7619079-7619101 CTACGTGTCTCTGGGCAAGTTGG + Intronic
977067815 4:92341504-92341526 TTGAGTGGCCTTGGGGAAGCTGG - Intronic
980760013 4:137220443-137220465 CTAAGTGTCCAAGGGAAAGGAGG + Intergenic
983936296 4:173505141-173505163 CTAATTGTCTCTGGTGAAGGGGG - Intergenic
986785169 5:11107588-11107610 AAAAGTATCCCTGGAGAAGCAGG - Intronic
987782232 5:22454125-22454147 CTTACTGTCCATGGGGAAGGGGG + Intronic
989466410 5:41760911-41760933 CAAACTTTCCCAGGGGAAGCAGG + Intronic
989466683 5:41764775-41764797 CTAACTGTGGCTGGGAAAGCAGG + Intronic
993280887 5:85922842-85922864 CTAAGTTTCACGGGGGAAGGAGG + Intergenic
1001966064 5:175910763-175910785 CTAAGGCTCCCTGCGGGAGCTGG + Intergenic
1002250882 5:177928439-177928461 CTAAGGCTCCCTGCGGGAGCTGG - Intergenic
1003525008 6:6890261-6890283 CTAAGTTACCCTGGGAGAGCTGG + Intergenic
1003780903 6:9425170-9425192 CTAAGTGACCTCGGGGAAACAGG - Intergenic
1006516945 6:34550467-34550489 CTTGGAGACCCTGGGGAAGCAGG - Intronic
1007368424 6:41410160-41410182 CCAAGTGTCCCTGGTGAGGAGGG + Intergenic
1007622853 6:43225473-43225495 CCAAGTGTTCCTGGGGAGGAGGG + Intergenic
1015023707 6:128507810-128507832 CTAACTCTCCCTCTGGAAGCAGG - Intronic
1016843392 6:148546166-148546188 CTAAATGTGCCTCAGGAAGCTGG - Intronic
1017162178 6:151375671-151375693 CTCAGCCTCCCTGGGGTAGCTGG + Intronic
1017718041 6:157225587-157225609 CTGAGTTTCCCAGGGGAAGTGGG + Intergenic
1017955016 6:159169957-159169979 CTAAGTGTCCCGGGAGATTCAGG + Intronic
1018992631 6:168685766-168685788 CTGAGGGCCCCTGGGGAAGAAGG - Intergenic
1019259175 7:71066-71088 CTGAGGGTCGCTGGGGATGCTGG + Intergenic
1019885387 7:3899827-3899849 CTCAGTGTGCCTGGGGTGGCAGG - Intronic
1023342018 7:39230943-39230965 CCAAGTGACCCTGGGGGAGTAGG - Intronic
1024671592 7:51600477-51600499 CTGGGTGTCCCTGGGGAGGCTGG + Intergenic
1024691000 7:51803182-51803204 CTAAGTCTGCATGGGCAAGCCGG - Intergenic
1025613200 7:63096224-63096246 CAAAGTGGCCCTGGGCAAGGTGG + Intergenic
1025942149 7:66082494-66082516 CAAAGTGGCCCTGGGCAAGGTGG - Intronic
1026162330 7:67880701-67880723 CAAAGAGGCCCTGGGGAAGCTGG + Intergenic
1028562911 7:92195168-92195190 CTATGTGTCCCTTGGGAGCCAGG + Intergenic
1030550951 7:110958975-110958997 TTAAGGGTACCTGGGGAAGTAGG - Intronic
1030862838 7:114658164-114658186 CTGAGGGTCCCTGGGTAATCGGG - Exonic
1032900828 7:136305592-136305614 AAAATTTTCCCTGGGGAAGCTGG - Intergenic
1033732027 7:144189444-144189466 CACAGTGTTCCTGGGGAAGCAGG - Intronic
1033742876 7:144288027-144288049 CACAGTGTTCCTGGGGAAGCAGG - Intergenic
1033751026 7:144361587-144361609 CACAGTGTTCCTGGGGAAGCAGG + Intronic
1034165420 7:149021700-149021722 CCAAATGTCCCAGGGGAAGTTGG + Intronic
1034430079 7:151036771-151036793 CTATGCATCCCTGGGGAAGCTGG - Intronic
1034449205 7:151128461-151128483 CAAAGTGGCCCAGGAGAAGCGGG + Intronic
1034554235 7:151839830-151839852 CACGGTGTCCCTGGGGAAGGCGG - Intronic
1034652793 7:152705328-152705350 TTGAGTGTCCATGGGCAAGCTGG - Intergenic
1036442024 8:8789862-8789884 CTCAGTGGCCCTGGGGCAGAGGG - Intronic
1037433159 8:18835580-18835602 CCAAGGGGCCGTGGGGAAGCAGG + Intronic
1038144724 8:24884642-24884664 CACAGTGTACGTGGGGAAGCTGG + Intergenic
1038445182 8:27598730-27598752 CTAGGTTTCCTTGGAGAAGCAGG - Intronic
1039544661 8:38400915-38400937 CTAAGTGTTCCAGGGCCAGCTGG - Exonic
1040023443 8:42761047-42761069 CCACGTGGCCCAGGGGAAGCTGG - Intronic
1041939927 8:63375614-63375636 CTGACTGTTCCTGGGGAAGGAGG - Intergenic
1045027676 8:98104046-98104068 CTTTAAGTCCCTGGGGAAGCAGG + Intronic
1045552686 8:103186609-103186631 TCAAGAGTCCCTGGGGTAGCAGG - Intronic
1045556519 8:103219565-103219587 CTAAGTGTAGATGGGGAAGGGGG + Intronic
1045691904 8:104767873-104767895 CTAAATGTCCTTGGGGGAGGAGG + Intronic
1047108932 8:121767107-121767129 CTGAGTTCCCCTGGGGATGCAGG - Intergenic
1047670500 8:127141262-127141284 CTGAGTGTCCTTGGGCAAGTTGG + Intergenic
1048102959 8:131375074-131375096 ATAAGTGGTACTGGGGAAGCTGG + Intergenic
1049594209 8:143475988-143476010 GTAAGGGTCCCTGGGGCTGCAGG + Intronic
1050512606 9:6412035-6412057 CTCAGCCTCCCTGGGGTAGCTGG - Intergenic
1051682936 9:19626280-19626302 CTGAGTGGCCCTGAGGCAGCTGG - Intronic
1053619394 9:39800208-39800230 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053877554 9:42559547-42559569 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053895100 9:42734830-42734852 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054234140 9:62542147-62542169 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054264762 9:62907235-62907257 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1057302359 9:93894341-93894363 CAAAGTGTCCCTGGGTACCCTGG + Intergenic
1057744156 9:97738240-97738262 CAATGTGTCCCTGGGTAGGCAGG - Intergenic
1062217438 9:135396939-135396961 CTAAGGGGCCTTGGGGAGGCTGG - Intergenic
1062380441 9:136284346-136284368 CTAGGTGTCCCTGGTGGACCTGG + Intronic
1062745541 9:138209419-138209441 CTGAGGGTCGCTGGGGATGCTGG - Intergenic
1185619078 X:1442464-1442486 CTAAGTGTGGCTGGGGAGCCGGG + Intronic
1189044836 X:37579431-37579453 CTAAGTGACCATGGGGCAGGTGG + Intronic
1189813755 X:44804396-44804418 CTAAATGTCCCTGGGGGTGGGGG - Intergenic
1190190551 X:48273477-48273499 CTCACTGGCCCTGGAGAAGCTGG + Intronic
1190198507 X:48340573-48340595 CTCATTGGCCCTGGAGAAGCTGG - Intergenic
1190596247 X:52054479-52054501 CAAAGGTGCCCTGGGGAAGCTGG - Intergenic
1190612577 X:52199594-52199616 CAAAGGTGCCCTGGGGAAGCTGG + Intergenic
1190664347 X:52683360-52683382 CTCATTGGCCCTGGAGAAGCTGG + Intronic
1190665270 X:52690986-52691008 CTCATTGGCCCTGGAGAAGCTGG - Intronic
1190674152 X:52767433-52767455 CTCATTGGCCCTGGAGAAGCTGG + Intronic
1190675075 X:52775062-52775084 CTCATTGGCCCTGGAGAAGCTGG - Intronic
1191034141 X:56006966-56006988 CTCACTGTGCCTGGGCAAGCTGG + Intergenic
1193354328 X:80499988-80500010 ATAAATGTTGCTGGGGAAGCTGG + Intergenic
1193901799 X:87188996-87189018 CGCTGTGTCCCTGGGCAAGCAGG + Intergenic
1194362484 X:92970123-92970145 ATAAGTGGCCCTGGGGAAATTGG - Intergenic
1197728867 X:129793940-129793962 CTAAGTGTCCCTGGGGAAGCAGG - Exonic
1198226815 X:134652976-134652998 GGAAGTGTCCCTGGGCTAGCAGG + Intronic
1198312069 X:135433758-135433780 CGAAGCGGCCCTGGAGAAGCAGG + Intergenic