ID: 1197733419

View in Genome Browser
Species Human (GRCh38)
Location X:129831527-129831549
Sequence CCTTTGTCTGGCCTACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197733419_1197733423 19 Left 1197733419 X:129831527-129831549 CCTGCTTGTAGGCCAGACAAAGG No data
Right 1197733423 X:129831569-129831591 CGCTATGCCATCAAGGATAAAGG No data
1197733419_1197733422 12 Left 1197733419 X:129831527-129831549 CCTGCTTGTAGGCCAGACAAAGG No data
Right 1197733422 X:129831562-129831584 TGAATTACGCTATGCCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197733419 Original CRISPR CCTTTGTCTGGCCTACAAGC AGG (reversed) Intronic