ID: 1197733419 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:129831527-129831549 |
| Sequence | CCTTTGTCTGGCCTACAAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197733419_1197733423 | 19 | Left | 1197733419 | X:129831527-129831549 | CCTGCTTGTAGGCCAGACAAAGG | No data | ||
| Right | 1197733423 | X:129831569-129831591 | CGCTATGCCATCAAGGATAAAGG | No data | ||||
| 1197733419_1197733422 | 12 | Left | 1197733419 | X:129831527-129831549 | CCTGCTTGTAGGCCAGACAAAGG | No data | ||
| Right | 1197733422 | X:129831562-129831584 | TGAATTACGCTATGCCATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197733419 | Original CRISPR | CCTTTGTCTGGCCTACAAGC AGG (reversed) | Intronic | ||