ID: 1197734893

View in Genome Browser
Species Human (GRCh38)
Location X:129843406-129843428
Sequence CCGCGCCCGCGGCTCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197734893_1197734901 13 Left 1197734893 X:129843406-129843428 CCGGGGCCGAGCCGCGGGCGCGG 0: 1
1: 0
2: 3
3: 49
4: 373
Right 1197734901 X:129843442-129843464 GCCCTGACTCCGCCACGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 100
1197734893_1197734906 27 Left 1197734893 X:129843406-129843428 CCGGGGCCGAGCCGCGGGCGCGG 0: 1
1: 0
2: 3
3: 49
4: 373
Right 1197734906 X:129843456-129843478 ACGCCGCGGACCACCGCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197734893 Original CRISPR CCGCGCCCGCGGCTCGGCCC CGG (reversed) Intronic
900117037 1:1033326-1033348 CTGCGCCCGCGGCCCCGCCCTGG - Intronic
900435575 1:2629162-2629184 CTGAGTCCGCAGCTCGGCCCCGG + Intronic
900438479 1:2642257-2642279 CCGCCCCACCGGCTGGGCCCAGG + Intronic
901130741 1:6961539-6961561 TCACGCCCCCGGCTCAGCCCAGG - Intronic
901483136 1:9539755-9539777 GGGCGCGCGCGGCTGGGCCCGGG - Intronic
902246516 1:15124475-15124497 CTGCGCCCCAGGCGCGGCCCGGG + Intergenic
902304119 1:15524295-15524317 CTGCCCCCGCGTCACGGCCCCGG + Exonic
902451501 1:16499352-16499374 CCCCGCCCCCGCCTCGGCCCCGG - Intergenic
904500112 1:30908509-30908531 CCGGGGCCGCGGCCGGGCCCGGG - Exonic
904738234 1:32651361-32651383 TCGAGGCCGCGGCTCAGCCCAGG - Intronic
906062539 1:42958192-42958214 CCGAGCCCCCGGCCCGGCCCCGG - Intronic
906318016 1:44800522-44800544 CCGCTCCCCCGGCCGGGCCCGGG + Exonic
906917190 1:50023997-50024019 CCGCCCCCGCGGCGCGAGCCCGG + Intergenic
907261331 1:53220675-53220697 CCTGCCCCGCGGCCCGGCCCCGG - Intergenic
908293125 1:62688001-62688023 CCGCGCCCGCCGCTGAGCCTCGG - Intronic
909001411 1:70221673-70221695 CCGGGCCCGCCGCTGGGGCCCGG - Exonic
912381324 1:109249664-109249686 CCCCGACCCCGGCCCGGCCCCGG - Intergenic
912915739 1:113812517-113812539 CCGCGCCCCCGCCGCGTCCCCGG + Intergenic
913209360 1:116570496-116570518 CCGCGCCCGCTCCCCGTCCCGGG + Intronic
913274172 1:117121709-117121731 CCTCTCCCGCGCCTCGGCCCGGG + Exonic
914242274 1:145859792-145859814 CGGCGGCCGCGGCTCCGCCCGGG + Intronic
915165697 1:153946642-153946664 CGGCGCCCGCGGCCCGGAGCGGG - Exonic
915722196 1:157993636-157993658 GCCCGCCCGCGGCTGGGGCCCGG - Exonic
916773446 1:167936197-167936219 CCCCGCCCGCGCCTCGGGGCGGG - Intronic
917456863 1:175193003-175193025 CCGCTCCAGGGGCTCGGCCCAGG + Intergenic
918066585 1:181105569-181105591 CCGCGCCACTGGCACGGCCCGGG - Intergenic
918240328 1:182615126-182615148 CCGCGGCCGCGGCTCTTCCGGGG - Intergenic
918480753 1:184974397-184974419 CCGCGCCCGCTGCTAGCTCCTGG + Exonic
921089558 1:211830408-211830430 CCGCGCCCCCGCCTCCTCCCCGG + Intronic
922124911 1:222712522-222712544 CCGCCCCCGAGGCCCCGCCCCGG + Exonic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
922586400 1:226737528-226737550 CGGCGCTCCCGGCTCAGCCCCGG + Exonic
922718039 1:227887154-227887176 CCCCGCCCCCTGCCCGGCCCAGG - Intergenic
922739362 1:228006867-228006889 CCCCGCCCGGGCCCCGGCCCCGG + Intergenic
923161360 1:231317492-231317514 CGGCGCCCGCGGGCCGGCACGGG + Intergenic
923490261 1:234478341-234478363 CCGCGCCCGCGGCGCGCGCGAGG - Exonic
1062873880 10:930957-930979 CCGCGACCCCGGCCCCGCCCAGG + Intronic
1062966625 10:1612119-1612141 CGGCCCCCTCGGCTCAGCCCTGG - Intronic
1062982517 10:1737147-1737169 CCGCGCCTGGGTCTCGGCCATGG - Exonic
1063407737 10:5813170-5813192 CCGCCCCGGCTGCTCAGCCCCGG + Intronic
1064086523 10:12349743-12349765 CTGCGCCCGCGCCGCGCCCCCGG + Exonic
1064418088 10:15168201-15168223 CCCCGCCGGCGGCCTGGCCCAGG - Intronic
1065022216 10:21509980-21510002 CTGCGCCCCCCGCTCGCCCCTGG + Intergenic
1065025314 10:21534890-21534912 CCGCGGCCGCGGCACGGGGCGGG - Intronic
1066389069 10:34964330-34964352 CCGCCCACGCGGCTCGGCTGGGG - Intergenic
1067071860 10:43138387-43138409 GCGCGCCCGCGGCCCCGCCCAGG - Intergenic
1068910536 10:62374481-62374503 CTGCGCCCGCGGCTCGGCGGAGG + Intronic
1068989127 10:63133283-63133305 GCGGGCCCGCGGCGCGGCGCCGG + Exonic
1070895843 10:79982369-79982391 CCGCTCCCGCGGCGGGGCCGTGG + Intronic
1073137889 10:101229793-101229815 ACGCGGCCGCCGCTCGGGCCAGG + Exonic
1074772511 10:116742839-116742861 CCGCTCCCGCAGCGCAGCCCCGG - Intergenic
1074829857 10:117240941-117240963 CCGCGGCCGCGCCTCTTCCCCGG - Intergenic
1074830093 10:117241667-117241689 CCGCGCCCGCAGCGGAGCCCCGG + Exonic
1075352337 10:121734917-121734939 CCGAGCCAGTGGCTCTGCCCAGG + Intergenic
1075401364 10:122163652-122163674 CGGCGTGCGCGGCTCTGCCCGGG - Intronic
1075748430 10:124743981-124744003 CCGCCGCCGCCGCCCGGCCCCGG + Intronic
1076373310 10:129968255-129968277 CCGCGCCTGCAGCTCAGCACTGG - Intergenic
1076792761 10:132785738-132785760 CCGCGCCCACGGGCCGGCCCAGG + Exonic
1076809517 10:132879364-132879386 CCCAGCCCGCGGCCCGTCCCGGG + Intronic
1077043730 11:535449-535471 CCCCGCCCCGGCCTCGGCCCCGG - Exonic
1077044300 11:537674-537696 CCGCGCCCACGCCTCGGCGCAGG - Intronic
1077281621 11:1748634-1748656 GCGCGCCCGCGGGTGCGCCCCGG - Intronic
1077914710 11:6603755-6603777 CCGCGCCCGCAGCCCGCCGCCGG - Intronic
1078225151 11:9384912-9384934 CCGCGCCTCCGGCCAGGCCCCGG - Intronic
1079122518 11:17695914-17695936 CCGCAGCCCCGGCCCGGCCCCGG - Intergenic
1080230901 11:30017045-30017067 CCACACCCTCGGTTCGGCCCTGG - Intergenic
1081465442 11:43312270-43312292 CCGCAGCCCCCGCTCGGCCCGGG - Intronic
1083227552 11:61294559-61294581 GCGTGCCCGTGGCTCTGCCCGGG - Intronic
1083329658 11:61891609-61891631 CCCCGCCCCCGGCCAGGCCCCGG + Intronic
1083879141 11:65539719-65539741 CCGTGCCCGCCGCGCGGCGCGGG - Exonic
1083901821 11:65647026-65647048 CCTCGCCCACGGCTTGGCCGGGG - Exonic
1085208111 11:74749198-74749220 CCGCGCCCGCGGCCCAGGCTGGG + Exonic
1085208143 11:74749306-74749328 CCGCGCCCCCGTCCCGGCGCGGG - Exonic
1087175312 11:95090243-95090265 CGGCGCCCGCAGCCCGGCTCGGG - Intronic
1089499822 11:118925510-118925532 CCGGCCCCGCGCCCCGGCCCCGG - Intronic
1093175676 12:15911253-15911275 CCGGGCCCGCGACTCCGCCCCGG + Exonic
1094107874 12:26832970-26832992 CCGCAGCTGCGGCTTGGCCCCGG - Exonic
1096105908 12:48997114-48997136 CCGACCCCTCGGCTCTGCCCTGG + Exonic
1096106524 12:48999363-48999385 CCGGGCCCGCGGCTCTGCAGTGG - Intergenic
1097267742 12:57755599-57755621 CCGGGGTTGCGGCTCGGCCCGGG - Exonic
1101371811 12:104137822-104137844 CCGCGGCCCCTCCTCGGCCCCGG + Intronic
1103410844 12:120710506-120710528 CGGCGTCGGCGGCTGGGCCCGGG + Exonic
1103749961 12:123151518-123151540 CCGCGCCCGGGGCTGGGCTTCGG - Intergenic
1103764497 12:123271167-123271189 CCCCGCTCCCGGCGCGGCCCGGG + Intronic
1103944276 12:124517591-124517613 GCGCTCCCGAGGCTCTGCCCTGG - Intronic
1105578631 13:21674461-21674483 CCGCGCCCCCGCCTCCGCTCCGG + Intronic
1106157518 13:27171850-27171872 GCCCGCCCCCGGCTCCGCCCCGG + Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1108541987 13:51453348-51453370 CCGCGCGCGCGGGGCGGCCGCGG + Intronic
1110444229 13:75559328-75559350 CCGCGCCCGGCCCTCAGCCCCGG + Intronic
1112344119 13:98576602-98576624 CCGCGCGCCCGGCTCGGCCGGGG - Intronic
1112344303 13:98577173-98577195 CCGCCCCCACGGCCCGGCCGGGG + Intronic
1112580630 13:100674368-100674390 CGGCGCCTGCGGCGCGTCCCCGG - Intronic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1114063323 14:19038742-19038764 CCTCTCCCCCGGCTCCGCCCTGG - Intergenic
1114098933 14:19361254-19361276 CCTCTCCCCCGGCTCCGCCCTGG + Intergenic
1114485165 14:23057650-23057672 CCGCCCCCGCCGCGCGGGCCCGG - Intergenic
1114485885 14:23061482-23061504 CTGCTCCCGCTGCTCTGCCCGGG + Exonic
1117392010 14:55271504-55271526 CCCCGGCCGCGGCCTGGCCCGGG - Exonic
1117478306 14:56118759-56118781 CCCCGCCCGCGCCGCTGCCCGGG - Intronic
1118725876 14:68628671-68628693 CCACGCCCGCGACTCAGCCCAGG - Intronic
1122658638 14:103279519-103279541 CAGCACCCGCGGGACGGCCCCGG - Intergenic
1123493224 15:20799439-20799461 CCTCTACCGCGGCTCAGCCCTGG + Intergenic
1123549731 15:21368541-21368563 CCTCTACCGCGGCTCAGCCCTGG + Intergenic
1124231191 15:27947585-27947607 CCGCACCCGCAGGGCGGCCCAGG - Intronic
1124696675 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG + Intronic
1125709624 15:41774445-41774467 CCCAGCCCGCGGCTTGGCCCAGG + Intronic
1125834253 15:42736476-42736498 CCACGCTCGCGGGCCGGCCCCGG + Exonic
1126109383 15:45166833-45166855 CCACGCCCGAGGGTCTGCCCGGG + Intergenic
1126852135 15:52804037-52804059 CAGCGGCCGCGTCACGGCCCGGG - Intergenic
1127753419 15:62067984-62068006 GCCCGCCCGCGCCCCGGCCCCGG + Exonic
1127763641 15:62164607-62164629 GCCCGCCCGCGCCCCGGCCCCGG - Exonic
1128743177 15:70097021-70097043 CCGCGCCCGCCGCCCGGCCCCGG - Exonic
1128841454 15:70854184-70854206 GCGCGCCTGCCGCTCGGCCCAGG + Intronic
1128992504 15:72272547-72272569 CCGCCCCCGCGGGGCGTCCCGGG - Exonic
1129468720 15:75738529-75738551 CCGTGCCCCCAGCCCGGCCCGGG - Intergenic
1130390162 15:83447777-83447799 CCTGGCCCCCGGCTCTGCCCTGG + Intronic
1131119780 15:89814935-89814957 GCCCGCCCGCAGCTCCGCCCGGG + Intronic
1131735493 15:95327019-95327041 CGGCCCCCGCGGCTCGGACCCGG - Intergenic
1132079490 15:98852345-98852367 CCGCGCCCGCGCCGCCGCCGTGG + Intronic
1202958062 15_KI270727v1_random:95759-95781 CCTCTACCGCGGCTCAGCCCTGG + Intergenic
1132575211 16:660939-660961 CCCGCCCCACGGCTCGGCCCAGG + Intronic
1132583067 16:694151-694173 CCGCGCCCCCGGCCCAGCGCGGG - Exonic
1132641953 16:982045-982067 CCGCGACCCCCGCGCGGCCCAGG - Exonic
1132683452 16:1153026-1153048 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1132719504 16:1308975-1308997 TCCCGCCCGCGCCCCGGCCCAGG + Exonic
1132933772 16:2471240-2471262 CCCCGCCCCCGGCTGGGCCCGGG + Intergenic
1132934971 16:2475437-2475459 GCTGGCCCGCGGCCCGGCCCAGG + Intronic
1133038094 16:3046019-3046041 CTGCGCGCGGGGCTCGGCCTGGG - Intergenic
1133273767 16:4624807-4624829 CCCCACCCCCGGCTCGGCCCGGG - Exonic
1134121403 16:11587026-11587048 CCGCCCCCGCGGCCCGCACCTGG + Intronic
1135335803 16:21599912-21599934 CCACGCCCCCGCCCCGGCCCCGG - Intronic
1136519530 16:30786891-30786913 CCGCGCCCGGGGCTGTGGCCGGG - Intronic
1136534974 16:30893961-30893983 CCCCGCCGCGGGCTCGGCCCCGG - Exonic
1136590352 16:31214670-31214692 CCGCGCTCCCGGCCCAGCCCTGG - Intronic
1136779092 16:32885937-32885959 CCGCGCCCCCGGCCCCGACCGGG + Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1136891525 16:33975581-33975603 CCGCGCCCCCGGCCCCGGCCGGG - Intergenic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138514642 16:57529232-57529254 TCGCGCCCGCCGCGCGTCCCCGG - Exonic
1138539371 16:57679174-57679196 CAGGGCCCCCGGCTCGGCCTGGG + Exonic
1139546738 16:67653193-67653215 GCGCGGCCGCGGCCGGGCCCGGG - Exonic
1139597889 16:67968689-67968711 CCGCCCCCGAGGGGCGGCCCGGG - Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1140078516 16:71723558-71723580 CCGCGCCCGCGTCCAGGCCTCGG - Intronic
1141608833 16:85170131-85170153 CCGCGCCCCCCGCGAGGCCCTGG - Intergenic
1141699480 16:85635900-85635922 CCACGGCCGCTGCTGGGCCCAGG - Intronic
1141828582 16:86497397-86497419 CCGCGCGCGGGGCTCGGCCGAGG + Intergenic
1141830945 16:86509850-86509872 CTCCGCCCGCGGTTCAGCCCCGG - Intergenic
1141840059 16:86568354-86568376 GTGCGCCGGCCGCTCGGCCCCGG - Exonic
1141972431 16:87492712-87492734 CGCCGCCCGCGCCTCCGCCCAGG + Intergenic
1142429686 16:90019408-90019430 CTGCGGCAGCGACTCGGCCCCGG + Intronic
1203081507 16_KI270728v1_random:1148025-1148047 CCGCGCCCCCGGCCCCGGCCGGG + Intergenic
1142549915 17:732344-732366 ACGCGCGCGCGCCGCGGCCCCGG + Intergenic
1142764708 17:2058639-2058661 CTGCGCCAGCAGCTCGGCCGCGG - Exonic
1143443947 17:6996304-6996326 CCGCGAGCCCAGCTCGGCCCGGG - Intronic
1143598443 17:7929344-7929366 CCGCCCCCGGGGCCCGGCCGGGG + Exonic
1144021178 17:11241107-11241129 CCCCGCGCGCGGCTCGGCTCAGG - Intergenic
1144586905 17:16492418-16492440 TCGCCCCCGCGCCACGGCCCCGG - Intergenic
1145243522 17:21253049-21253071 GCGCGCCCGCGGCCCGGCTCCGG - Intronic
1147311603 17:39599117-39599139 CCGCGCCCCAGCCTCGGCCTGGG + Intergenic
1147440282 17:40443488-40443510 CCGCATCCTCGGCCCGGCCCAGG - Exonic
1147720395 17:42536314-42536336 CCGCGCCCCCGGCCCCGGCCAGG - Exonic
1147971038 17:44219241-44219263 CAGCGGCCGGGGCTCGGCTCAGG + Intronic
1147980860 17:44273053-44273075 CAGCACCCTCGGCTGGGCCCTGG + Intergenic
1148733438 17:49851394-49851416 CCGCGGCCGCGACCCGCCCCCGG - Intergenic
1148818226 17:50345998-50346020 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1149712636 17:58756596-58756618 GCGCCCCCGCTGCTCGGACCCGG + Intronic
1150239942 17:63622915-63622937 CCGCTCGCGCGCCGCGGCCCGGG + Intronic
1151801993 17:76384324-76384346 CTGCGCTCGCGGCCGGGCCCGGG + Intronic
1152321493 17:79610672-79610694 ACGCGCCCTCGGGTCAGCCCCGG + Intergenic
1152353646 17:79796814-79796836 CCGCGGCCGCTGCTGGGACCTGG + Intronic
1152396303 17:80035759-80035781 CCGCCCCCGCGGCCCCGTCCGGG + Intronic
1152468054 17:80476706-80476728 CCGGGCCCGCGGCGCGGCGGGGG + Intronic
1152617043 17:81342816-81342838 AGGCGGCCCCGGCTCGGCCCAGG - Intergenic
1152689770 17:81712615-81712637 CCGCGCCCGGGGCTCCCTCCTGG + Intronic
1152798987 17:82322413-82322435 CCGTGCCCACAGCTCTGCCCTGG + Intronic
1152864904 17:82716726-82716748 CCGCGGCCGCGGACCCGCCCCGG - Exonic
1153893022 18:9535765-9535787 CTGCGCCTGCTGCTCGGCCTTGG - Exonic
1154070652 18:11149114-11149136 CCGCGCTCTGGCCTCGGCCCCGG + Intergenic
1154304164 18:13218321-13218343 CCCCGCCCGCGGGCCAGCCCCGG - Intronic
1154450775 18:14473976-14473998 CCTCTCCCGCGGCTCAGCCCTGG + Intergenic
1155654410 18:28177366-28177388 CAGCGCAGGCGGCTCGGCTCCGG + Exonic
1156448593 18:37254055-37254077 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1158601936 18:58863495-58863517 CGGCGGCGGCGGCTCGGCCCGGG - Intronic
1158781923 18:60662679-60662701 CCGCGCCAGTGGCTCGGAGCAGG + Intergenic
1160025360 18:75211572-75211594 CTGCGCCCGCGGCCCGCGCCGGG + Intronic
1160617846 18:80147546-80147568 TCACGGCCGCAGCTCGGCCCGGG + Intergenic
1160763740 19:798053-798075 TCGGGCCCGCGGCGAGGCCCCGG - Intronic
1160992208 19:1864415-1864437 CCGCGCCCGCGGCGGGGCCCGGG + Intergenic
1161215811 19:3094586-3094608 CCCGGCCCCCGGCCCGGCCCTGG - Exonic
1161398882 19:4059007-4059029 CCCCACCCAAGGCTCGGCCCTGG + Intronic
1161560299 19:4969287-4969309 CCGCCCCCGCGTCGCGGCTCGGG + Intronic
1162079356 19:8209297-8209319 CCGCCCCCACGGCCCCGCCCCGG + Intronic
1162398791 19:10432448-10432470 CAGCGCCCCGGGCCCGGCCCCGG + Intronic
1162741773 19:12777727-12777749 CCGCGCCCCCTGGTGGGCCCGGG - Intronic
1163720036 19:18894519-18894541 GGGCCCCCGGGGCTCGGCCCTGG + Intronic
1164508908 19:28881866-28881888 CCGCACCCGCGGCTTGTCTCTGG + Intergenic
1164565121 19:29320422-29320444 CTGCTCCCCCGTCTCGGCCCAGG + Intergenic
1165349739 19:35269190-35269212 CCGCGCCCCGGCCCCGGCCCCGG + Intronic
1165459512 19:35936458-35936480 CCCGGCCCCCGCCTCGGCCCCGG + Intronic
1166305155 19:41933101-41933123 TCGCGCCCTCGGCCTGGCCCTGG - Intergenic
1166367285 19:42284158-42284180 CCGGGCCCGAGGCTCAGCGCCGG - Intronic
1167502046 19:49854028-49854050 CCGTGCCCCAGGCTGGGCCCAGG - Intronic
1167738758 19:51311858-51311880 CTGCGCCCGGGGCCCGGCTCCGG + Exonic
1168239534 19:55082198-55082220 TCGTGCCCGCGCCCCGGCCCAGG - Intronic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
924962321 2:46133-46155 CCCGGCCCGCGCCCCGGCCCCGG - Exonic
926090015 2:10043565-10043587 CCGCCCGCGCGGCTCTGCCCCGG - Exonic
926202650 2:10812771-10812793 CCGCGCCCACGTCCCGCCCCAGG + Intronic
926206066 2:10835159-10835181 CTGTGGCCGCTGCTCGGCCCCGG + Intronic
926980212 2:18560389-18560411 CGGCGGCCGTGGCGCGGCCCAGG + Exonic
927713788 2:25340849-25340871 CGGCCCCCGCGGCCCGGGCCCGG + Intronic
927881491 2:26692818-26692840 CCCGGCCCGCGCCTCGGCCCCGG - Exonic
928432834 2:31234600-31234622 TCGCGGCCGCCGCTCGCCCCCGG - Exonic
931253871 2:60554207-60554229 CCGAGCCCGCGGCTGCGCTCGGG + Intergenic
932152727 2:69387454-69387476 TCCCTCCCGCGGCTCGCCCCGGG - Intergenic
933666878 2:84971325-84971347 CCGCCCCCGCGGCCGAGCCCGGG + Exonic
933975339 2:87504834-87504856 CCGCCCCCACCGCTCTGCCCTGG - Intergenic
933995348 2:87664098-87664120 CAGGGCCAGCGGCTCAGCCCTGG + Intergenic
934754480 2:96816092-96816114 CCACGCCCCCGGCCCGCCCCTGG + Intergenic
934933223 2:98445138-98445160 CCGCGCCCGCTGTCCGTCCCCGG - Intronic
934966944 2:98731354-98731376 CCGAGACCGCGGCTCCGCTCCGG - Intergenic
935275763 2:101474266-101474288 CCTCGGCCATGGCTCGGCCCCGG + Intronic
936298512 2:111286818-111286840 CAGGGCCAGCGGCTCAGCCCTGG - Intergenic
936318487 2:111445979-111446001 CCGCCCCCACCGCTCTGCCCTGG + Intergenic
937084040 2:119158820-119158842 CCGCCTCCGCCGCTCAGCCCCGG - Exonic
938058360 2:128233469-128233491 CGGCGCCCGCGTCTCCGCCGGGG + Intergenic
939900323 2:147843906-147843928 CCGCGCCCGCCGAGCTGCCCAGG - Intergenic
940293493 2:152099199-152099221 CCGCGCTCGCGGCGGGGTCCCGG + Intergenic
943060469 2:183037854-183037876 CGCCGCCCGAGGCCCGGCCCGGG - Intronic
944675871 2:202033946-202033968 TCGTGCCCGCGGCCTGGCCCCGG - Intergenic
944676016 2:202034511-202034533 CGCCGCCCACGGCCCGGCCCCGG + Intergenic
945245255 2:207711710-207711732 CCCGCCCCGCGGCCCGGCCCCGG - Intronic
946404059 2:219483525-219483547 CAGCTCCCGCGGCCCGGCCCGGG - Exonic
1168769797 20:408018-408040 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169065487 20:2692624-2692646 CCGCCGCCGCGGCCCGGGCCCGG + Intergenic
1169065577 20:2692839-2692861 CCGGGCCCGAGGCCAGGCCCCGG + Intergenic
1170630023 20:18057767-18057789 CCCCCGCCGCGGCGCGGCCCAGG + Exonic
1170889954 20:20368383-20368405 CGGCGCCGGGGGCTCGGCGCGGG - Exonic
1172666809 20:36605914-36605936 GCGCGCCCCAGGCCCGGCCCGGG + Exonic
1173251542 20:41366477-41366499 TGGCGCCCGCGGCTGCGCCCGGG - Exonic
1174258751 20:49278132-49278154 CCGCCCGCCCGGCTCCGCCCAGG - Exonic
1175847083 20:62064965-62064987 CCGCGCCCGCCACTCTGGCCCGG - Exonic
1175847322 20:62065591-62065613 CTGCGCCCGCGGCTCCGGCCGGG + Exonic
1175927161 20:62476436-62476458 CCGCACCCGGGGCTCGGTGCAGG + Intergenic
1176068846 20:63215814-63215836 CAGACCCCGCGCCTCGGCCCCGG + Intronic
1176103051 20:63373158-63373180 CCATGCCCGAGGCTCTGCCCTGG - Intronic
1176182177 20:63755127-63755149 CCGCAGCTGCGGCTCTGCCCTGG - Intronic
1176194599 20:63831372-63831394 CCGCGGCCGGGGCGCGGCGCGGG - Intergenic
1176194732 20:63831710-63831732 CAGCGCCCGGTGCGCGGCCCGGG - Intergenic
1176207215 20:63895493-63895515 CCGCGCCCCCGCCCCGGCCCAGG - Intronic
1176232274 20:64038563-64038585 CCCCGCGCCCGGCCCGGCCCGGG - Intronic
1176445456 21:6816598-6816620 CCTCTCCCGCGGCTCAGCCCTGG - Intergenic
1176547782 21:8208965-8208987 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176566724 21:8392003-8392025 CCGGGGCCGAGGCCCGGCCCGGG - Intergenic
1176566765 21:8392109-8392131 CCCCGCCGGCGGCGCGGCGCAGG - Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176574608 21:8436199-8436221 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176611221 21:8987491-8987513 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176823624 21:13681631-13681653 CCTCTCCCGCGGCTCAGCCCTGG - Intergenic
1177157333 21:17512931-17512953 CGGCGCTCGCAGCCCGGCCCGGG + Exonic
1177920301 21:27143751-27143773 CCGCAGCGGCGCCTCGGCCCCGG - Intergenic
1178314939 21:31559558-31559580 GCGCGCGCGCGGCTCGGCATCGG + Intronic
1178708015 21:34890085-34890107 CCGGGCCCGCGGCAACGCCCGGG - Intronic
1179893704 21:44350287-44350309 TCGCGCCCTCGCCCCGGCCCCGG - Intronic
1180172956 21:46070018-46070040 CCGCCCCCTCAGCTCGGCCCTGG - Intergenic
1180481819 22:15761376-15761398 CCTCTCCCCCGGCTCCGCCCTGG - Intergenic
1180782800 22:18530101-18530123 CCGCGCCCGCGGCGCCGGCCCGG - Intronic
1180950671 22:19719151-19719173 CCGCCCCCGCGGCTGGATCCGGG + Intronic
1181126362 22:20704133-20704155 CCGCGCCCGCGGCGCCGGCCCGG - Intergenic
1181177472 22:21045914-21045936 CCGCGCCCAGAGCGCGGCCCGGG - Intergenic
1181239690 22:21469439-21469461 CCGCGCCCGCGGCGCCGGCCCGG - Intergenic
1181514361 22:23402664-23402686 CCGCGCCCGCGCCGGCGCCCAGG - Intergenic
1182639319 22:31753961-31753983 CCGCTCCGGTGGCTCCGCCCCGG - Intronic
1183546013 22:38455233-38455255 CCGCGCCCTCGGCGCCGCCTCGG + Intergenic
1183856081 22:40636248-40636270 CCGCCCGCCCGGCCCGGCCCGGG + Intronic
1184523134 22:45007530-45007552 CCCCGCCCGCGCCGCGCCCCCGG - Intronic
1185055144 22:48575492-48575514 CCGCCCGCTCGGCTCGGCGCCGG - Intronic
1185055248 22:48575829-48575851 CCGCGCCCGGCGCGCAGCCCCGG + Intronic
1185278911 22:49961617-49961639 GCGCGCCAGCGGCTCGTCCAGGG - Exonic
1185342920 22:50299659-50299681 CCGCGCCCGTGGGTAGGCGCGGG + Intronic
1203252656 22_KI270733v1_random:125250-125272 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203260712 22_KI270733v1_random:170336-170358 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
949969961 3:9396603-9396625 CGGCGGCCGCGGCTCCGCCCCGG - Intergenic
954110257 3:48429505-48429527 CCCCGCCCGCCGCCCGGGCCAGG + Intronic
958814676 3:98901953-98901975 CCGCGGCCCCCGCCCGGCCCGGG + Intergenic
959849805 3:111072325-111072347 CCGCGCCCGGGGCGAGGCCCTGG + Intronic
961377333 3:126475698-126475720 GCGGGCCCGGGGCGCGGCCCGGG - Exonic
962818137 3:139020689-139020711 CCACGTCCGCTGCTAGGCCCAGG - Exonic
963091586 3:141487532-141487554 CCGCGCCCCCGGCCGCGCCCCGG - Intronic
966868583 3:184276086-184276108 CCGCTCCCGGGCCGCGGCCCCGG - Intronic
968405772 4:338079-338101 CCGCTGCCGCCGCTCAGCCCTGG + Intronic
968515800 4:1015169-1015191 CCGGGCTTGCTGCTCGGCCCAGG + Intronic
968549368 4:1214368-1214390 CCGGATCCGCGGCGCGGCCCTGG - Exonic
968879774 4:3292990-3293012 CCCCGCCCTCGCCTCGACCCCGG + Intergenic
969288306 4:6222085-6222107 CGGCGCCCGCCGCTGCGCCCGGG - Intergenic
971257948 4:25030962-25030984 TCGCGCCCGCAGCCCGGCTCTGG + Intergenic
972321623 4:37977558-37977580 CCGCGCCTGCCGCTCCGCTCCGG - Intronic
976765501 4:88593214-88593236 CCTCGCCCCCGGCCCCGCCCAGG - Intronic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
985537444 5:473165-473187 CCCCGCCCCCGGCTCGCCCTCGG + Intergenic
991999020 5:72417539-72417561 TCGCGGCGGCGGCTCGGCCTGGG - Intergenic
994197272 5:96935223-96935245 CGGCGCCCGCGACCCGGGCCGGG + Intronic
996698403 5:126423552-126423574 CCGCGCGCCTGGCTCTGCCCCGG - Intronic
997402200 5:133611966-133611988 CCGAGCCCGCAGCTCGCGCCCGG - Intronic
997704108 5:135930628-135930650 CCCCTCCCGCGGCCCGGGCCCGG + Intronic
999727270 5:154446816-154446838 CCCCGCTCGCGTCTGGGCCCCGG + Intronic
999767971 5:154755409-154755431 CCCCGCCCCCGGGGCGGCCCGGG - Intronic
1000209484 5:159096927-159096949 CCTCGTCCCCGGCTCGGCTCGGG - Intronic
1002071322 5:176680355-176680377 CCGCGCCCGGGAGCCGGCCCAGG - Intergenic
1002638375 5:180619146-180619168 GCGCGCCCGCAGCGCGCCCCGGG - Intronic
1004627926 6:17393938-17393960 CCGCGCCCGCGCCCCGCGCCCGG - Intronic
1004660643 6:17706462-17706484 CCTCCCCCGCCGCCCGGCCCCGG + Exonic
1005298641 6:24449924-24449946 CCGAGGCCGTGGCTCAGCCCAGG - Intronic
1005847421 6:29792563-29792585 CGGCGCCCGCGGCTCCATCCTGG - Intergenic
1006491556 6:34392442-34392464 GCGCGCCCCCGGCTCGGCCAAGG + Exonic
1006814327 6:36840055-36840077 CCCCGCCCGCGGCCCCGCCCCGG - Intergenic
1006932765 6:37697614-37697636 CGGCGCCCGCGCCGCAGCCCCGG - Exonic
1007390259 6:41546545-41546567 CCCCGCCCCCGGCCCAGCCCTGG - Exonic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007701781 6:43770120-43770142 CCCCGCCCCCGGCCCGCCCCGGG - Intergenic
1008760426 6:54846784-54846806 CCGCGCCCGCCGCACAGCGCCGG - Exonic
1009437686 6:63636330-63636352 AGGCGCCAGCGGCGCGGCCCAGG - Intronic
1010209889 6:73354338-73354360 CCCCGCCCCCGGCCCGGGCCAGG + Intergenic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1016596991 6:145814492-145814514 CAGCGCCAGCGCCTCGGTCCCGG + Intronic
1016714113 6:147204128-147204150 CCGCCGCCCCGGCTCGCCCCCGG - Intergenic
1017163779 6:151390283-151390305 CCGCGCCCCCGGCCCCGCCCCGG - Intronic
1017725726 6:157274893-157274915 CCGGGGCCGCCGCTCGGCCGTGG - Intergenic
1017737733 6:157380318-157380340 CCGCGCCCGCAGCTCCTCCTGGG + Intergenic
1017738119 6:157381634-157381656 CCCCGGCCGCGCCTCGGCTCTGG - Exonic
1018400303 6:163414553-163414575 CCCCGCCCGCCGCCCGCCCCCGG + Intronic
1018628730 6:165804790-165804812 CTCCGCCCGCGGCCCGGCCCCGG - Intronic
1018876762 6:167827544-167827566 CCGCGAGCGCGGCGCGGCCCCGG + Intronic
1019343627 7:519643-519665 CCGCGGGCGCTGCCCGGCCCCGG - Intronic
1019515888 7:1440037-1440059 CCCCGCCCTCGGCTCTGCCAGGG + Exonic
1019681965 7:2355328-2355350 CAGCGCCCGGGGTTCGGCCTCGG - Exonic
1019990116 7:4684108-4684130 CCGCACCCTCTGCTCTGCCCCGG + Intronic
1020106538 7:5424702-5424724 GCGCGCCCCCCGCTCGGCCCAGG + Intronic
1021958804 7:25852590-25852612 CCGCGCCCCCGCCCCGGCTCGGG + Intergenic
1022207580 7:28179721-28179743 CCGCGTCCCCGGCCCCGCCCGGG + Intronic
1023810348 7:43906618-43906640 GCGCGGCCGCGGCTCGGCGCCGG + Exonic
1024262416 7:47582203-47582225 CCGCGCCCGCGCCCCGAGCCTGG + Intronic
1025078719 7:55964627-55964649 GCGCGCCCGCGGAGCGGCCTGGG + Exonic
1025777304 7:64570405-64570427 CTGCGCCCGGGGCCCGGCTCCGG - Intergenic
1026899177 7:74027710-74027732 CCGCCCCTCCGGCTGGGCCCCGG - Intergenic
1027250122 7:76393668-76393690 ACGCGGCCGCGGCACGGACCCGG + Exonic
1028135511 7:87219857-87219879 CGCCGCCCGCCGCTCGCCCCCGG + Intronic
1029123212 7:98281763-98281785 CCGCGCCCGCCGCTCCGGCCCGG - Exonic
1030348197 7:108456252-108456274 CCGCGCCCTCCGCTCAGCTCTGG + Exonic
1031406752 7:121396024-121396046 CCGGGCCCGGGGCCCGCCCCCGG + Intronic
1032090805 7:128910604-128910626 CCGCGCCCGCGGCCAGCGCCAGG + Exonic
1032130759 7:129225370-129225392 CCGCGACGGCGGCGAGGCCCTGG + Exonic
1032194428 7:129780958-129780980 CCGCGTCCGCGCCCCAGCCCCGG - Intergenic
1033186505 7:139231624-139231646 CGGGGCCGGCGGCTCCGCCCGGG - Exonic
1033186567 7:139231825-139231847 CCGCGGCGGCTGCTCAGCCCGGG - Exonic
1033339339 7:140479533-140479555 GCGCGCCCGCGGCCCGCCCACGG + Exonic
1033390725 7:140924837-140924859 CTCCGCCCGCGGCGCCGCCCGGG - Intergenic
1033595333 7:142854929-142854951 CGGCGCCCGCTCCTCCGCCCCGG - Intergenic
1033732826 7:144195634-144195656 CCCCACCCGCGGCCCGCCCCTGG + Exonic
1033750225 7:144355383-144355405 CCCCACCCGCGGCCCGCCCCTGG - Exonic
1034174507 7:149090423-149090445 CCGCTCCCGCGGCTTGTCCGTGG - Intronic
1034342714 7:150368684-150368706 GGGCGCCCGCGCCCCGGCCCCGG + Intronic
1034431935 7:151045490-151045512 CCCTGCCAGCTGCTCGGCCCCGG - Exonic
1034446161 7:151115272-151115294 CCGCGCCCGCCGCGCAGCACTGG - Intronic
1034781646 7:153887237-153887259 GGACGCCGGCGGCTCGGCCCCGG - Intronic
1035476123 7:159145100-159145122 CCGCGCCCTCTCCTCGCCCCTGG + Intergenic
1035553483 8:545999-546021 CCGTTCCCGCGGCTCCGTCCCGG - Intergenic
1036789439 8:11708474-11708496 CAGAGCCCGCGCCTCCGCCCTGG - Exonic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1041108000 8:54459657-54459679 CCGCGCCCGCCGCCCGCCCCGGG - Exonic
1045063431 8:98426828-98426850 TTGCGCCCCCGGCTCGGCGCGGG - Intronic
1045489091 8:102655753-102655775 CCCCGCCCGCGGCGCGGGGCAGG - Exonic
1047998611 8:130358714-130358736 CCCCGCCCGCGCCCCGCCCCCGG + Intronic
1049013211 8:139901785-139901807 CCGTGCCCCCGGCTCTGCCACGG + Intronic
1049109758 8:140635527-140635549 GCGCGGCCGCCCCTCGGCCCCGG - Exonic
1049219811 8:141424041-141424063 CCCAGCCCACGGCTCAGCCCTGG - Intronic
1049237263 8:141518568-141518590 CCGCGCGCGGGGCCCGGGCCCGG + Exonic
1049419571 8:142510823-142510845 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1052799573 9:32955701-32955723 CTGCGGCCGCTGCTCCGCCCAGG - Intergenic
1053306209 9:36986345-36986367 GCGCGGCCGCGGCGGGGCCCGGG - Intronic
1053786344 9:41655245-41655267 CCGCCCCCGCCTCCCGGCCCCGG - Intergenic
1054781977 9:69174146-69174168 CCGCGCTGGCCGCCCGGCCCGGG - Intronic
1056992336 9:91423699-91423721 CGGCGCTCGGGGCTCGGGCCGGG + Exonic
1058153311 9:101486049-101486071 CCGCATCCTCTGCTCGGCCCAGG - Intronic
1058991233 9:110256591-110256613 CCGCGCCCGTCGCTGCGCCCCGG + Exonic
1059176768 9:112175256-112175278 GCGCGCCCGCGCCTCCTCCCGGG + Exonic
1060296527 9:122347143-122347165 GAGCGCCCGCGGAGCGGCCCGGG + Intergenic
1060770111 9:126326615-126326637 CCGAGCCCGCGCCGCCGCCCCGG - Intergenic
1060952603 9:127613114-127613136 CAGGGACCGCGGCGCGGCCCGGG - Intronic
1061061062 9:128250766-128250788 CCGTGCCCCCAGCCCGGCCCGGG + Exonic
1061221230 9:129253390-129253412 CCCCGCCCTGGGCTCGGCCTGGG + Intergenic
1061293670 9:129666049-129666071 GCCCTCCCGCGCCTCGGCCCTGG - Exonic
1061293713 9:129666168-129666190 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1061559655 9:131394281-131394303 CCGCCCCCACGCCCCGGCCCCGG - Intronic
1062628640 9:137454042-137454064 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628657 9:137454080-137454102 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628674 9:137454118-137454140 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628691 9:137454156-137454178 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628708 9:137454194-137454216 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062658371 9:137615507-137615529 CCAGCCCCGCGGCTCCGCCCAGG - Exonic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1203523739 Un_GL000213v1:67927-67949 CCTCTCCCGCGGCTCAGCCCTGG + Intergenic
1203469059 Un_GL000220v1:108401-108423 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203476880 Un_GL000220v1:152373-152395 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1186466318 X:9786586-9786608 CGCCGCCCGCGTCTCGGCCTCGG - Exonic
1188451105 X:30308860-30308882 CAGCGCCCGAGGCACGGCCAGGG - Exonic
1190320537 X:49177013-49177035 CAGCTGCGGCGGCTCGGCCCTGG + Exonic
1190385639 X:49879966-49879988 CCCCGGCCCCGGCGCGGCCCTGG + Exonic
1190745810 X:53321193-53321215 CCCCTCCCCCGGCTGGGCCCGGG - Exonic
1196804737 X:119574383-119574405 CTGCGCTCGCGGCCCCGCCCCGG + Intergenic
1196936133 X:120733005-120733027 CCGAGCCCGCCGCTCGGCCGAGG - Intergenic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1199760121 X:150898711-150898733 GCGCGCGCGCGGCGCGGCCCCGG + Intronic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1200177173 X:154125440-154125462 CCGCGCCCCAGCCTCAGCCCCGG + Intergenic