ID: 1197742481

View in Genome Browser
Species Human (GRCh38)
Location X:129905922-129905944
Sequence CCTGGCCCCTGGTTTCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197742481_1197742492 15 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742492 X:129905960-129905982 GCGCCAGAGAAATACGGGGTGGG No data
1197742481_1197742491 14 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742491 X:129905959-129905981 CGCGCCAGAGAAATACGGGGTGG No data
1197742481_1197742490 11 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742490 X:129905956-129905978 CCGCGCGCCAGAGAAATACGGGG No data
1197742481_1197742494 18 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742494 X:129905963-129905985 CCAGAGAAATACGGGGTGGGTGG 0: 1
1: 0
2: 2
3: 15
4: 199
1197742481_1197742495 25 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742495 X:129905970-129905992 AATACGGGGTGGGTGGAGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 258
1197742481_1197742486 9 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742486 X:129905954-129905976 ACCCGCGCGCCAGAGAAATACGG No data
1197742481_1197742488 10 Left 1197742481 X:129905922-129905944 CCACGTGGAAACCAGGGGCCAGG No data
Right 1197742488 X:129905955-129905977 CCCGCGCGCCAGAGAAATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197742481 Original CRISPR CCTGGCCCCTGGTTTCCACG TGG (reversed) Intergenic