ID: 1197744583

View in Genome Browser
Species Human (GRCh38)
Location X:129923209-129923231
Sequence CAGGATCAACTTGGGAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197744576_1197744583 21 Left 1197744576 X:129923165-129923187 CCAGATCTAAGGAGCTACAATGG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1197744583 X:129923209-129923231 CAGGATCAACTTGGGAATGGAGG 0: 1
1: 0
2: 0
3: 17
4: 332
1197744579_1197744583 -9 Left 1197744579 X:129923195-129923217 CCAAAGCTAGACAGCAGGATCAA 0: 1
1: 0
2: 3
3: 22
4: 132
Right 1197744583 X:129923209-129923231 CAGGATCAACTTGGGAATGGAGG 0: 1
1: 0
2: 0
3: 17
4: 332
1197744575_1197744583 28 Left 1197744575 X:129923158-129923180 CCAAAGGCCAGATCTAAGGAGCT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1197744583 X:129923209-129923231 CAGGATCAACTTGGGAATGGAGG 0: 1
1: 0
2: 0
3: 17
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197744583 Original CRISPR CAGGATCAACTTGGGAATGG AGG Intronic
900734325 1:4286188-4286210 CAGGGTCTACTTGAGAGTGGGGG - Intergenic
901787915 1:11637033-11637055 CAAGATCAACTTGGCCATTGGGG + Intergenic
902171713 1:14616793-14616815 CAGGATACACTTGGGAAGGCTGG + Intronic
904446570 1:30577804-30577826 CAGGATTGACTTGGCAATGCAGG - Intergenic
904851159 1:33460802-33460824 GAGCATCAACATGGGAAGGGAGG + Intergenic
906714897 1:47960891-47960913 CAGGATTGACTTGGCAATGCGGG - Intronic
906793946 1:48681794-48681816 TAGGATTAACTGGGGAGTGGGGG + Intronic
906837060 1:49095364-49095386 TAGGATTAACTTGGCAATGTGGG - Intronic
911314337 1:96338018-96338040 CAGGGTCTACTTGAGGATGGAGG + Intergenic
911585877 1:99689811-99689833 GAGCATCAAATGGGGAATGGTGG - Exonic
911879911 1:103224286-103224308 GAGGATCTTATTGGGAATGGAGG + Intergenic
911949614 1:104155457-104155479 CAAGATCAACCTGGGTAAGGTGG + Intergenic
912739366 1:112179321-112179343 AAGGATCACCCTGGGAATGAAGG - Intergenic
912959644 1:114184090-114184112 TAGGATTGACTTGGCAATGGGGG + Intergenic
915587761 1:156853499-156853521 CAGGTTCAAGGTGGGCATGGGGG - Intronic
915900827 1:159845519-159845541 CAACATGAACTTGGGCATGGAGG - Intronic
916194548 1:162211094-162211116 CAGGCTCATCTTGGGAATGAGGG + Intronic
917007705 1:170433549-170433571 CAGAATCTACTTGAGGATGGAGG + Intergenic
917237011 1:172904773-172904795 AAGGATTAACTGGGCAATGGAGG - Intergenic
917679703 1:177353407-177353429 CATGATCAAATTGGGAGTTGTGG + Intergenic
917740908 1:177961347-177961369 CATTATCAAGTTGGGAAAGGAGG - Intronic
918152470 1:181809760-181809782 CAGGCTCAGGTTGGGACTGGAGG - Intergenic
918314985 1:183316129-183316151 CATGCTCTCCTTGGGAATGGAGG + Intronic
921206437 1:212853514-212853536 AAAGATCAAGTTGGAAATGGAGG - Intergenic
922397143 1:225213368-225213390 TAGGATTGACTTGGCAATGGGGG + Intronic
923416338 1:233765633-233765655 TAGGATTAACTTGGCAATGCGGG + Intergenic
1063169241 10:3491815-3491837 CAGAATCCACTTGAGAGTGGAGG + Intergenic
1063710793 10:8476038-8476060 CAGGAGGAACTGGGGTATGGAGG - Intergenic
1065782151 10:29179731-29179753 CAGGTTCAACTTGCCAATGATGG + Intergenic
1066218091 10:33308198-33308220 CAGGGTCTACTTGAGGATGGAGG + Intronic
1066537126 10:36404096-36404118 TAGGATTAACTTGGCAATGCAGG - Intergenic
1066817330 10:39436111-39436133 CAGGATTGACTTGGCAATGCGGG + Intergenic
1068105126 10:52605405-52605427 TAGGATTAACTTGGCAATGTGGG + Intergenic
1070473153 10:76803624-76803646 CATTATTAAATTGGGAATGGGGG + Intergenic
1070503807 10:77095769-77095791 CTGGCTCAACTTGGGCATGCAGG - Intronic
1071906892 10:90183977-90183999 TAGGATTGACTTGGGAATGCGGG + Intergenic
1072032460 10:91534312-91534334 TAGGATTGACTTGGGAATGTGGG - Intergenic
1072366387 10:94714639-94714661 CAGGATTGACTTGGCAATGTGGG + Intronic
1072532765 10:96335198-96335220 CAGGAACACCTTGGGAAAGGAGG - Intronic
1072902007 10:99416622-99416644 TAGGATTGACTTGGCAATGGGGG - Intronic
1075477242 10:122746568-122746590 CTGGAACAACATGGAAATGGGGG - Intergenic
1076053554 10:127353325-127353347 CAGGAGCAAAATGGGAATGGGGG + Intronic
1076724124 10:132405432-132405454 CAGTTTCAACTTGGGGATGGAGG - Exonic
1078592583 11:12657533-12657555 CAGTAGCAACTAGGCAATGGAGG + Intergenic
1079900183 11:26173455-26173477 CAGGATTGACTTGGCAATGCGGG - Intergenic
1081656447 11:44860772-44860794 CAAGCTCAACTGGGGAAGGGTGG + Intronic
1082102166 11:48181666-48181688 CAGGATCTCATTGGGCATGGTGG - Intergenic
1082219490 11:49617392-49617414 CAGGAGCATCTTTTGAATGGAGG - Intergenic
1082575837 11:54802314-54802336 AAGGATTGACTTGGGAATGCGGG - Intergenic
1084749104 11:71192279-71192301 CAGGTTCAACTTAGGAATTCAGG + Intronic
1086580666 11:88394562-88394584 CAGGATTGACTTGGCAATGTGGG + Intergenic
1087451175 11:98326361-98326383 CAGGATTGACTTGGCAATGCGGG + Intergenic
1087648151 11:100831914-100831936 CAAAATCCACTTGGAAATGGAGG + Intronic
1087677498 11:101179989-101180011 CAGTATGAACTTGGGCAAGGGGG - Intergenic
1087870174 11:103284107-103284129 CAGAATCACCTGGGGAATGGTGG - Intronic
1088509113 11:110556296-110556318 TAGGATTAACTTGGCAATGTGGG + Intergenic
1089133230 11:116228745-116228767 TAGCATCAACTGGGCAATGGGGG + Intergenic
1090812070 11:130253749-130253771 TAGGATTAACTTGGCAATGCAGG - Intronic
1091662043 12:2391526-2391548 CAGGGTCAAGCTGGGAATGCTGG + Intronic
1092706315 12:11289098-11289120 TAGGATCGACTTGGCAATGCAGG - Intergenic
1093046926 12:14457435-14457457 CAGGATCAAACTGGGTATGGTGG + Intronic
1093072824 12:14724329-14724351 CAGGATCTGCTTTGGGATGGAGG + Intergenic
1093418658 12:18949461-18949483 AAGGATCCAGTTGGGCATGGGGG + Intergenic
1094249107 12:28339126-28339148 CAGAATCCAGTTGGGCATGGTGG - Intronic
1094735777 12:33232227-33232249 CAGGATTGACTTGGCAATGCGGG - Intergenic
1095146929 12:38741211-38741233 TAGGATTGACTTGGGAATGCGGG - Intronic
1095232004 12:39750591-39750613 TAGGATCGACTTGGCAATGCGGG - Intronic
1095360548 12:41333350-41333372 CAGGTTCAAGTTGGGGGTGGCGG - Intronic
1096010635 12:48211438-48211460 CAGATCCAAATTGGGAATGGTGG + Intergenic
1096712949 12:53471140-53471162 TAGGATGAAATTGGGCATGGCGG + Intronic
1096953933 12:55506156-55506178 TAGGATTGACTTGGGAATGCGGG + Intergenic
1097178233 12:57155979-57156001 CAGGATGAATTGGGGAATGCAGG + Intronic
1097429000 12:59480133-59480155 TAGGATTAACTTGGCAATGTGGG + Intergenic
1098283193 12:68882243-68882265 CAGCATCTACTTGAGGATGGAGG - Intronic
1099534838 12:83830505-83830527 TAGGATTGACTTGGCAATGGGGG + Intergenic
1100047000 12:90394873-90394895 CAGCATTAAGTTGGGCATGGTGG + Intergenic
1101740635 12:107497261-107497283 GAGGATAAAGTTGGGGATGGTGG - Intronic
1101909039 12:108849059-108849081 TAGGATCAACTTGGCATTAGAGG + Intronic
1103498552 12:121382110-121382132 TAGGATCAAGCTGGGCATGGTGG - Intronic
1104831149 12:131752637-131752659 CCGGATTAACGTGTGAATGGAGG + Intronic
1105233181 13:18520041-18520063 TAGGATTGACTTGGCAATGGGGG - Intergenic
1106984108 13:35324036-35324058 TAAGATCAACTTGGCAATAGAGG + Intronic
1108153742 13:47564035-47564057 CAGGTTCCACTGGGGTATGGGGG - Intergenic
1109187560 13:59288715-59288737 CAGGAAAACCATGGGAATGGTGG + Intergenic
1110871847 13:80461618-80461640 CAGGATTATCTCTGGAATGGGGG - Intergenic
1111575155 13:90143988-90144010 TAGGATTGACTTGGGAATGTGGG + Intergenic
1111651729 13:91099337-91099359 TAGGATAAACTTGGAAATGAAGG + Intergenic
1114048394 14:18897246-18897268 CAGGATTGACTTGGCAATGTGGG - Intergenic
1114114119 14:19504400-19504422 CAGGATTGACTTGGCAATGCGGG + Intergenic
1114115819 14:19622152-19622174 CAGGATTGACTTGGCAATGTGGG + Intergenic
1114982216 14:28179075-28179097 CAGGATTGACTTGGCAATGTGGG + Intergenic
1115233783 14:31188866-31188888 CAGGATGAAGTTGTGTATGGAGG - Intronic
1115941699 14:38617620-38617642 CAGGATCTGCATGGGAAGGGAGG - Intergenic
1117087092 14:52212811-52212833 CAGGATTGACTTGGCAATGTGGG - Intergenic
1120280127 14:82428839-82428861 CAGGATCCTCTCTGGAATGGGGG - Intergenic
1121255688 14:92528595-92528617 CATGATCATCTGGGAAATGGGGG + Intronic
1123882934 15:24692259-24692281 TAGGATTGACTTGGCAATGGGGG + Intergenic
1125767142 15:42143501-42143523 CAGCACCCACATGGGAATGGGGG + Intronic
1125774141 15:42195850-42195872 TAGGATCGACTTGGCAATGCAGG - Intronic
1125938090 15:43654519-43654541 CAGGATTGACTTGGCAATGCGGG - Intronic
1127189128 15:56510993-56511015 TAGGATTGACTTGGCAATGGGGG + Intergenic
1127748190 15:62002981-62003003 CAGGATTGACTTGGCAATGCGGG + Intronic
1128772027 15:70289984-70290006 AAGGATAAGCTTCGGAATGGGGG + Intergenic
1131565469 15:93481558-93481580 CAGAATAAACTGGGGAAGGGCGG - Intergenic
1131628438 15:94149423-94149445 CAGGATTGACTTGGCAATGCGGG + Intergenic
1132012114 15:98285284-98285306 CAAGATCAAACTGGGCATGGTGG - Intergenic
1133661394 16:7921362-7921384 AAGGATCAGCTTGAGAATGGGGG + Intergenic
1133730290 16:8572818-8572840 TAGGAAGAACTTGGGATTGGGGG + Intronic
1133761447 16:8801889-8801911 CAGGAGCAACTGGGAAATGATGG + Exonic
1134199599 16:12187174-12187196 CAGGGGCATCTTGTGAATGGTGG - Intronic
1135784750 16:25338854-25338876 CAGGATTGATCTGGGAATGGAGG - Intergenic
1136110023 16:28058970-28058992 CAGGATGAACTGGGGAGTGGGGG + Intronic
1136157079 16:28390282-28390304 CAGGCTCACCTTGGGAGTGAGGG + Exonic
1136206007 16:28724999-28725021 CAGGCTCACCTTGGGAGTGAGGG - Exonic
1136344529 16:29666105-29666127 GAGGGTCAACCTGGGCATGGGGG + Exonic
1138875188 16:60940586-60940608 TAGGATTAACTTGGCAATGCGGG - Intergenic
1141651322 16:85394610-85394632 CAGGATCACCTTGAGATTGCAGG + Intergenic
1143380011 17:6490188-6490210 CGGGCTCACCTGGGGAATGGGGG - Intronic
1145970823 17:28955551-28955573 CAGGATTAACTTGACCATGGTGG - Exonic
1148345218 17:46898554-46898576 GAAACTCAACTTGGGAATGGAGG + Intergenic
1149570852 17:57671432-57671454 CAGGATCAGCTTGGGAAGAGAGG - Intronic
1150307443 17:64098311-64098333 TAGGATAACCTTGGGAGTGGGGG - Intronic
1153420249 18:4897249-4897271 CAGGATTGACTTGGCAATGCGGG - Intergenic
1154520109 18:15218449-15218471 TAGGATTGACTTGGCAATGGGGG + Intergenic
1156387623 18:36620199-36620221 CAGACACATCTTGGGAATGGTGG - Intronic
1158734515 18:60064382-60064404 CAGGATTGACTTGGGAACTGTGG - Intergenic
1159072985 18:63646775-63646797 CAAGCTCATCCTGGGAATGGAGG + Intronic
1159742674 18:72192231-72192253 TAGGATTGACTTGGGAATGCGGG + Intergenic
1160432865 18:78824114-78824136 CAGCCTCAACTTGGAAACGGAGG + Intergenic
1160993861 19:1872944-1872966 CAGGATCAAGGTGGGAGTGCAGG - Intergenic
1162247618 19:9415563-9415585 CAGAATAAAGCTGGGAATGGTGG - Intronic
1162356976 19:10192140-10192162 AAGGATTAACTTGGGCATGGTGG + Intronic
1165002894 19:32779488-32779510 CAGGATCCCCTTGGGAATCCTGG + Intronic
1167395322 19:49224657-49224679 CTGGAGCAACTTGGGGCTGGGGG - Intergenic
1167889050 19:52525475-52525497 CTGGCTCTACTTGGTAATGGAGG - Intergenic
1167890230 19:52534281-52534303 CTGGCTCTACTTGGTAATGGAGG - Intronic
1167894303 19:52568924-52568946 CTGGCTCTACTTGGTAATGGAGG - Intronic
1167914288 19:52727471-52727493 CTGGCTCTACTTGGTAATGGAGG + Intronic
1167915574 19:52737371-52737393 CTGGCTCTACTTGGTAATGGAGG + Intergenic
1167930482 19:52859298-52859320 CTGGCTCTACTTGGTAATGGAGG + Intergenic
1167938364 19:52925636-52925658 CTGGCTCTACTTGGTAATGGAGG + Intergenic
1168003289 19:53466352-53466374 CTGGCTCTACTTGGTAATGGAGG - Intergenic
1168597740 19:57692754-57692776 CAGGAAATACTGGGGAATGGGGG - Intronic
925825660 2:7846480-7846502 CAGGTTGAACTTGGGTATTGAGG - Intergenic
926265780 2:11319065-11319087 CAGGATTGACTTGGCAATGTGGG + Intronic
927540614 2:23907668-23907690 TAGGATTGACTTGGCAATGGGGG - Intronic
928006493 2:27566929-27566951 AAGGAACAACTTGGGAATTCCGG + Exonic
928104243 2:28457551-28457573 CAGGACCAAGATGGAAATGGGGG + Intronic
928632958 2:33213033-33213055 AAGGATCAACTGAGGAAAGGCGG - Intronic
928802189 2:35108312-35108334 CAGGATTGACTTGGCGATGGGGG + Intergenic
930870238 2:56163260-56163282 TAGGATTGACTTGGGAATGCGGG + Intergenic
936612440 2:114014437-114014459 CAGGATTGACTTGGCAATGCAGG + Intergenic
938425758 2:131185753-131185775 CAGGATTGACTTGGCAATGCGGG - Intronic
940545867 2:155084427-155084449 CAGGGCCTACTTGAGAATGGAGG - Intergenic
940548357 2:155118699-155118721 TAGGATTAACTTGGCAATGCAGG + Intergenic
940768133 2:157811574-157811596 CAGGAAGAAAATGGGAATGGAGG - Intronic
943858979 2:192835402-192835424 CAGGATTGACTTGGCAATGCGGG + Intergenic
946106849 2:217378226-217378248 TAGGATCGACTTGGCAATGCAGG - Intronic
947261697 2:228230488-228230510 CAGGATTGACTTGGCAATGCGGG + Intergenic
948123470 2:235547863-235547885 CAGGGTGAACTTGGTAATGGAGG + Intronic
1169566409 20:6858026-6858048 CTGGTTCAACTTGTGAAAGGCGG + Intergenic
1170343239 20:15353032-15353054 CAGGATTGACTTGGCAATGCGGG - Intronic
1170492802 20:16896077-16896099 CAGGGTCAAAGTGGCAATGGTGG - Intergenic
1171764610 20:29251926-29251948 TAGGATTGACTTGGCAATGGAGG - Intergenic
1172024279 20:31937383-31937405 CAGGAGCCACCTGGGAAGGGAGG - Exonic
1172058035 20:32167818-32167840 CATGATCCACTTGGGTATGCCGG + Intergenic
1176777164 21:13148310-13148332 TAGGATTGACTTGGCAATGGGGG - Intergenic
1177044466 21:16151941-16151963 CAGGATTGACTTGGCAATGCGGG + Intergenic
1177196751 21:17911458-17911480 CAGGCTCCACCTGGGAAGGGAGG - Intronic
1177272841 21:18871538-18871560 CAGGATTGACTTGGCAATGTGGG + Intergenic
1177294007 21:19151751-19151773 CAGGATTGACTTGGCAATGTGGG - Intergenic
1177758808 21:25379448-25379470 CGGGGTCTACTTGGGGATGGAGG + Intergenic
1178644081 21:34370586-34370608 CAGCATCAACTTTGGCTTGGAGG - Exonic
1178903987 21:36621196-36621218 CAGGATTGACTTGGCAATGCGGG - Intergenic
1179068153 21:38045874-38045896 CAGGATAAACTCAGGAAGGGAGG + Intronic
1181323246 22:22025135-22025157 CAGGGTGAAATTGGGAATGGGGG - Intergenic
1181406239 22:22686861-22686883 CAGGCTCAACTTGGGATCTGTGG - Intergenic
1182893170 22:33836217-33836239 TAGGATCAACTAGTGAATGGGGG - Intronic
1183630833 22:39031681-39031703 CAGGATCCACCTGGGGAAGGAGG - Exonic
1183634349 22:39052061-39052083 CAGGATCCACCTGGGGAAGGAGG - Exonic
1184598118 22:45526453-45526475 CAGGAGGAACTTGGGCCTGGAGG + Intronic
950336606 3:12199590-12199612 CAGGAGAAACTTGAGAGTGGGGG - Intergenic
950630967 3:14281744-14281766 CAGGAGCAAATTGGGGAGGGCGG - Intergenic
951416627 3:22431870-22431892 TAGTATCAACTTGGGAATTCTGG - Intergenic
952760857 3:36912962-36912984 CAAGATTAACTCGGGAATGCTGG + Intronic
953525154 3:43683609-43683631 CAGGATTGACTTGGCAATGCAGG - Intronic
955431884 3:58854515-58854537 CAGGATTGACTTGGCAATGTGGG - Intronic
955582792 3:60442734-60442756 CAGGATTGACTTGGCAATGCGGG + Intronic
955886246 3:63601500-63601522 CAGGGTCTACTTGAGAGTGGAGG - Intronic
957306384 3:78463366-78463388 TAGGATTGACTTGGAAATGGGGG + Intergenic
957399225 3:79686897-79686919 CAGGATTGACTTGGCAATGTGGG - Intronic
958607490 3:96377476-96377498 CAGGATTGACTTGGCAATGTGGG + Intergenic
960375887 3:116900867-116900889 CTAGATAGACTTGGGAATGGGGG + Intronic
960759167 3:121053271-121053293 TAGGATTGACTTGGCAATGGGGG - Intronic
961170265 3:124792836-124792858 CAGGATTAACTTAGGATTGTGGG + Intronic
963812030 3:149787034-149787056 TAGGATCATCTTGGCAATGCGGG + Intronic
965240222 3:166187515-166187537 CAGGAGCTAATTGAGAATGGTGG - Intergenic
966279828 3:178213668-178213690 AAGAGTCAACTTGGGCATGGAGG - Intergenic
966341184 3:178926501-178926523 TAGGATTAACTTGGCAATGCAGG - Intergenic
966654621 3:182341689-182341711 CAGGACCTACTTGAGGATGGAGG + Intergenic
967606376 3:191451826-191451848 CAGGATCTGCTGTGGAATGGAGG + Intergenic
968272458 3:197414576-197414598 TAGGATCGACTTGGCAATGCGGG - Intergenic
970060912 4:12033150-12033172 CAAGATGAACTTGGAAGTGGTGG + Intergenic
972398369 4:38676511-38676533 CAGGAGCTTCTTGGGAGTGGCGG - Intronic
973344707 4:49042152-49042174 GAGGCTCAACTAGGGACTGGAGG + Intronic
973704602 4:53569192-53569214 TAGGATTGACTTGGCAATGGGGG - Intronic
973722484 4:53739316-53739338 TAGGATTGACTTGGCAATGGGGG - Intronic
974017794 4:56664786-56664808 GAGGAGGAACTGGGGAATGGTGG - Intronic
974426430 4:61748389-61748411 TAGGATTGACTTGGGAATGCAGG - Intronic
974460293 4:62178766-62178788 TAGGATTGACTTGGGAATGCGGG - Intergenic
975493469 4:75013100-75013122 CATGATCACCCTGGGAAAGGTGG - Exonic
976263516 4:83168724-83168746 TAGGATCATCTTGGCAATGAGGG - Intergenic
976680984 4:87755557-87755579 TAGGATCGACTTGGCAATGCAGG + Intergenic
977603450 4:98958423-98958445 CATGATAAACTTGGAAATTGGGG + Intergenic
978064366 4:104378214-104378236 TAGGATTATCTTGGCAATGGGGG - Intergenic
978254229 4:106674536-106674558 TAGGATTGACTTGGTAATGGGGG - Intergenic
978257664 4:106711845-106711867 TAGGATTGACTTGGCAATGGGGG + Intergenic
978548162 4:109895761-109895783 TAGGATTGACTTGGGAATGCGGG + Intergenic
978634248 4:110785150-110785172 CAGGTTCAACCAGGGAATGCAGG - Intergenic
980390059 4:132133405-132133427 TAGGATTAACTTGGCAATGTGGG - Intergenic
981100245 4:140821833-140821855 TAGGATTAACTTGGCAATGTGGG + Intergenic
981151326 4:141382443-141382465 TAGGATTAACTTGGCAATGCCGG - Intergenic
981224379 4:142275877-142275899 CAAGATCAAGTTGGGAATATGGG - Intronic
981506174 4:145502311-145502333 AAGCATGAATTTGGGAATGGGGG + Intronic
982136172 4:152276254-152276276 CAGGAGCTGCCTGGGAATGGTGG - Intergenic
983705508 4:170653765-170653787 CACAATCAACATGGGAATGTAGG - Intergenic
985085749 4:186310654-186310676 CAGGGTCTACTTGAGACTGGGGG - Intergenic
989072611 5:37527162-37527184 TAGGATTATCTTGGGAATGTGGG - Intronic
989733285 5:44673044-44673066 CAGGATTGACTTGGCAATGTGGG - Intergenic
989763345 5:45048072-45048094 TAGGATCGACTTGGCAATGTGGG - Intergenic
992360549 5:76033709-76033731 CAGGATTGACTTGGCAATGAGGG + Intergenic
992777739 5:80103171-80103193 CAGGACCCTCTCGGGAATGGGGG + Intergenic
992815379 5:80432114-80432136 TAGGATCGACTTGGCAATGCGGG - Intronic
992821763 5:80504867-80504889 CAGGATGAAGTTGGGGAAGGGGG - Intronic
993065831 5:83096069-83096091 CAGGATCTACTGTGGGATGGAGG + Intronic
994280669 5:97898615-97898637 TAGGATTGACTTGGCAATGGGGG + Intergenic
995337033 5:111011429-111011451 CAGGATCTACTGTGAAATGGAGG - Intergenic
995812412 5:116122443-116122465 CAGGATTGACTTGGCAATGAGGG + Intronic
996867376 5:128140797-128140819 CTGAAACAACTGGGGAATGGGGG - Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998157088 5:139793229-139793251 CAGGGTCAGGCTGGGAATGGTGG - Intergenic
999194349 5:149771868-149771890 CAGGATGAAATTGGCCATGGTGG - Intronic
999323238 5:150627311-150627333 GAGGGTCAACTGGGGAAGGGTGG + Intronic
999334628 5:150704993-150705015 CAGGACCGTCTTTGGAATGGGGG + Intergenic
1000556095 5:162728006-162728028 TAGGATCACCTAAGGAATGGGGG - Intergenic
1000566162 5:162849957-162849979 TAGGATCAACTTGGCGATGCGGG - Intergenic
1000566667 5:162856382-162856404 TAGGATCAACTTGGCGATGCGGG + Intergenic
1001046849 5:168380316-168380338 CAGAATCAGCTGGGGCATGGTGG + Intronic
1003089217 6:3087527-3087549 CAGGTTCAACTGTGGAATCGAGG - Intronic
1004604007 6:17176919-17176941 CAGCATGAACTGGGAAATGGAGG - Intergenic
1004749484 6:18546987-18547009 CAGGATTGACTTGGCAATGTGGG + Intergenic
1007158271 6:39767573-39767595 CAGGATTGACTTGGCAATGGGGG + Intergenic
1008281684 6:49603198-49603220 TAGGATTGACTTGGCAATGGGGG - Intergenic
1008334875 6:50290658-50290680 AAAGATAAACTTGGAAATGGAGG - Intergenic
1009476897 6:64103819-64103841 CAGGATCAAATTAAGAATGAGGG + Intronic
1010145123 6:72659291-72659313 CAGGAGCAAGTTTGGAATGAGGG - Intronic
1010204788 6:73313100-73313122 TAGGATTAACTTGGCAATGTGGG - Intergenic
1010598928 6:77799956-77799978 TAGGATTTACTTGGCAATGGGGG + Intronic
1010831147 6:80531152-80531174 CAATATCTAATTGGGAATGGAGG - Intergenic
1010849024 6:80748899-80748921 CAGGATTGACTTGGTGATGGGGG - Intergenic
1010982993 6:82390880-82390902 TAGGATTGACTTGGCAATGGGGG + Intergenic
1011515694 6:88150117-88150139 CAGGAGCTACTTGGAGATGGAGG - Intronic
1013377844 6:109536067-109536089 TAGGATTAACTTGGCAATGCAGG + Intronic
1013462897 6:110392778-110392800 CAGGTTTGACTTGGGAATGGGGG + Exonic
1013746253 6:113349957-113349979 CAGGACCATCTCTGGAATGGGGG + Intergenic
1014356617 6:120419243-120419265 TAGGATTAACTTGGCAATGTGGG - Intergenic
1015080834 6:129223804-129223826 TAGGATTGACTTGGGAATGTGGG + Intronic
1015952719 6:138570005-138570027 CAGGGGCAACTTGTGAAGGGAGG - Intronic
1018429433 6:163711936-163711958 CAGGCTGAACTTGGGAACGAAGG + Intergenic
1019839829 7:3430033-3430055 AAGTGCCAACTTGGGAATGGTGG + Intronic
1019927483 7:4202880-4202902 CAGGTTCACCTTGGGTCTGGTGG + Intronic
1021943423 7:25702325-25702347 TAGGATTGACTTGGTAATGGGGG - Intergenic
1022842482 7:34177979-34178001 GAGGAGCAATTTGGAAATGGGGG + Intergenic
1022994493 7:35740661-35740683 TAGGATTAACTTGGCAATGCGGG + Intergenic
1023143357 7:37124815-37124837 CAGGATTGACTTGGCAATGTGGG - Intronic
1023147338 7:37164799-37164821 CAGGATTGACTTGGCAATGCGGG + Intronic
1024273161 7:47657513-47657535 CAGGGACAAAATGGGAATGGAGG - Intronic
1024671075 7:51595460-51595482 CAGGATTGACTTGGAAATGTGGG + Intergenic
1028395112 7:90360600-90360622 TAGGATTGACTTGGCAATGGGGG + Intronic
1028436590 7:90811146-90811168 TAGGATTGACTTGGCAATGGGGG - Intronic
1028845937 7:95480077-95480099 CAGGACCAACCTGGAAGTGGAGG + Intronic
1029789546 7:102828044-102828066 TAGGATCGACTTGGCAATGCGGG + Intronic
1029808720 7:103023962-103023984 CAGGATCTACTTGAGGGTGGAGG + Intronic
1029849795 7:103449816-103449838 CAGGATTGACTTGGCAATGCGGG + Intergenic
1029891614 7:103935848-103935870 AAGGATCAAATTGGGAGTGGTGG - Intronic
1033064734 7:138143894-138143916 CAGGATGAAGCTGGGGATGGGGG + Intergenic
1033576232 7:142687427-142687449 TAGGATTAACTTGGCAATGCGGG + Intergenic
1033873089 7:145781377-145781399 TAGGATTGACTTGGCAATGGGGG + Intergenic
1036109614 8:5883427-5883449 TAGGATTAACTTGGCAATGCGGG + Intergenic
1036902882 8:12684854-12684876 CAGAATCACCTTGGGAACCGTGG + Intergenic
1037960521 8:23094451-23094473 CAGTATCAACTCAGGAATGCTGG + Intronic
1038969126 8:32611349-32611371 CATTATCAATTTGGGAAAGGGGG - Intronic
1039112880 8:34059446-34059468 CAGGATTGACTTGGCAATGAGGG - Intergenic
1041035174 8:53782002-53782024 TAGGATTAACTTGGCAATGCAGG + Intronic
1041282609 8:56226520-56226542 CAGGAGAAACTGGGGAGTGGGGG - Intergenic
1042014175 8:64288731-64288753 CAGAATTTGCTTGGGAATGGAGG - Intergenic
1042523363 8:69738083-69738105 CTCGATGAACTTGGGAATGAAGG + Exonic
1042628657 8:70791040-70791062 CACCATCACCTTGGGAATTGGGG + Intergenic
1042821113 8:72931259-72931281 TAGGATTGACTTGGCAATGGGGG + Intronic
1043989687 8:86737738-86737760 CAGGATCTACTTGAGGGTGGAGG - Intronic
1044643701 8:94415046-94415068 CAGGATTGACTTGGCAATGCGGG - Intronic
1044878254 8:96694969-96694991 CAGGATTGACTTGGCAATGCGGG - Intronic
1045160903 8:99542991-99543013 CAGGATTGACTTGGCAATGCGGG - Intronic
1045352519 8:101355274-101355296 CAGGAGCAATTTGGGAATTAAGG - Intergenic
1046281273 8:112035441-112035463 CAGGATCATGATGGGAAGGGTGG + Intergenic
1047227837 8:122971490-122971512 CAGGAGCATCTAGGGAATGTGGG + Intronic
1047918517 8:129608568-129608590 CAGCCTCAACTATGGAATGGAGG - Intergenic
1048118847 8:131555978-131556000 CTGGATCTACCTGGGAAAGGGGG + Intergenic
1048572015 8:135664350-135664372 CAGGAGCTACTTTGGAGTGGTGG + Intergenic
1051143107 9:13999446-13999468 TAGGATCGACTTGGCAATGTGGG - Intergenic
1052222761 9:26047383-26047405 TAGGATTAACTTGGCAATGTGGG - Intergenic
1052604368 9:30680270-30680292 CAGGATTGACTTGGCAATGCGGG + Intergenic
1055057934 9:72040549-72040571 CAGGATCATCTCTGAAATGGGGG - Intergenic
1055876526 9:80949401-80949423 CTGGATCCACTTGGGAATAAAGG - Intergenic
1056499874 9:87198197-87198219 CAGGATCGACTGGGGAATGACGG + Intergenic
1057464872 9:95303786-95303808 CAGCTTCAACTTATGAATGGGGG + Intronic
1058224383 9:102341875-102341897 TAGGATTAACTTGGCAATGTGGG - Intergenic
1060340701 9:122773990-122774012 CAGGGTCTACTTGAGAGTGGAGG + Intergenic
1203408492 Un_KI270538v1:70440-70462 CAGGATTGACTTGGCAATGTGGG - Intergenic
1188288837 X:28363544-28363566 CAGGATTGACTTGGCAATGTGGG + Intergenic
1188526404 X:31092713-31092735 GAGGCTCAACTTAGGATTGGAGG - Intergenic
1189342925 X:40218359-40218381 TAGGATGACCTTAGGAATGGAGG - Intergenic
1189409336 X:40755923-40755945 CAGGATCTACTATGGGATGGAGG + Intergenic
1190549411 X:51563483-51563505 CAGGATGGAGTGGGGAATGGTGG - Intergenic
1190686643 X:52880333-52880355 TAGGATTAACTTGGCAATGCGGG - Intergenic
1191018073 X:55831759-55831781 TAGGATTGACTTGGGAATGCAGG - Intergenic
1191959793 X:66688453-66688475 TAGGATTGACTTGGCAATGGGGG + Intergenic
1191983652 X:66954338-66954360 CAGGATTGACTTGGCAATGCAGG - Intergenic
1192255424 X:69452907-69452929 CAGGATTGACTTGGCAATGCGGG - Intergenic
1192293634 X:69824159-69824181 CAGGATTGACTTGGCAATGCAGG + Intronic
1192876646 X:75236478-75236500 CAGGATTGACTTGGCAATGCGGG - Intergenic
1192907071 X:75562732-75562754 CAGGATTGACTTGGCAATGCGGG + Intergenic
1192909774 X:75591034-75591056 CAGGATTGACTTGGCAATGTGGG - Intergenic
1192918201 X:75676855-75676877 CAGGATTGACTTGGCAATGTGGG + Intergenic
1192920682 X:75702684-75702706 CAGGATTGACTTGGCAATGCGGG - Intergenic
1193612632 X:83651029-83651051 TAGGATTGACTTGGGAATGCTGG + Intergenic
1194127609 X:90039582-90039604 CAGGATCAACTTGAGAAGACAGG - Intergenic
1194250845 X:91573034-91573056 TAGGATTAACTTGGCAATGCGGG - Intergenic
1195445002 X:104942161-104942183 TAGGATCATCTTGGAAATGCGGG + Intronic
1196015141 X:110931311-110931333 CAGGGCCTACTTGGGGATGGAGG + Intergenic
1196253002 X:113483924-113483946 TAGGATTGACTTGGCAATGGGGG - Intergenic
1196597340 X:117560318-117560340 CAGGATTGACTTGGCAATGTGGG - Intergenic
1197744583 X:129923209-129923231 CAGGATCAACTTGGGAATGGAGG + Intronic
1199131618 X:144195748-144195770 TAGGATCAACTTGGCCATGCGGG + Intergenic
1200216183 X:154369200-154369222 CAGGACCAACCTGGGAACTGGGG - Intronic
1201171384 Y:11269461-11269483 TAGGATTGACTTGGGAATGTGGG + Intergenic
1201615244 Y:15889979-15890001 CAGGATTGACTTGGCAATGTGGG - Intergenic
1201627471 Y:16030581-16030603 CAGGATTGACTTGGCAATGCAGG - Intergenic
1201937831 Y:19426640-19426662 AAGAATCAACTTGGGCCTGGAGG - Intergenic
1202024448 Y:20505756-20505778 CAGGATTGACTTGGCAATGCGGG - Intergenic