ID: 1197749598

View in Genome Browser
Species Human (GRCh38)
Location X:129955416-129955438
Sequence TTTCTATTGCCACCCATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197749598_1197749605 11 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749605 X:129955450-129955472 GAATGGGGTGCTTCTAAGCCAGG No data
1197749598_1197749608 26 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749608 X:129955465-129955487 AAGCCAGGTGTGTAGGTGGATGG No data
1197749598_1197749599 -6 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749599 X:129955433-129955455 TAGAAAGACCTCGCCCTGAATGG No data
1197749598_1197749600 -5 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749600 X:129955434-129955456 AGAAAGACCTCGCCCTGAATGGG No data
1197749598_1197749606 19 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749606 X:129955458-129955480 TGCTTCTAAGCCAGGTGTGTAGG No data
1197749598_1197749601 -4 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749601 X:129955435-129955457 GAAAGACCTCGCCCTGAATGGGG No data
1197749598_1197749609 27 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749609 X:129955466-129955488 AGCCAGGTGTGTAGGTGGATGGG No data
1197749598_1197749607 22 Left 1197749598 X:129955416-129955438 CCAAGGATGGGTGGCAATAGAAA No data
Right 1197749607 X:129955461-129955483 TTCTAAGCCAGGTGTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197749598 Original CRISPR TTTCTATTGCCACCCATCCT TGG (reversed) Intergenic
No off target data available for this crispr