ID: 1197749951

View in Genome Browser
Species Human (GRCh38)
Location X:129957403-129957425
Sequence CTGTCGCCGCGGCGCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197749951_1197749958 30 Left 1197749951 X:129957403-129957425 CCGGCCCTGCGCCGCGGCGACAG No data
Right 1197749958 X:129957456-129957478 CTTACCCAGCATGCACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197749951 Original CRISPR CTGTCGCCGCGGCGCAGGGC CGG (reversed) Intergenic
No off target data available for this crispr