ID: 1197749966

View in Genome Browser
Species Human (GRCh38)
Location X:129957487-129957509
Sequence TATCTCGGAGCCGCAGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197749955_1197749966 27 Left 1197749955 X:129957437-129957459 CCTACTCCGTCCGTCTGCGCTTA No data
Right 1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG No data
1197749959_1197749966 4 Left 1197749959 X:129957460-129957482 CCCAGCATGCACTTCCAGGCCCT No data
Right 1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG No data
1197749957_1197749966 17 Left 1197749957 X:129957447-129957469 CCGTCTGCGCTTACCCAGCATGC No data
Right 1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG No data
1197749956_1197749966 21 Left 1197749956 X:129957443-129957465 CCGTCCGTCTGCGCTTACCCAGC No data
Right 1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG No data
1197749962_1197749966 -10 Left 1197749962 X:129957474-129957496 CCAGGCCCTGAGCTATCTCGGAG No data
Right 1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG No data
1197749960_1197749966 3 Left 1197749960 X:129957461-129957483 CCAGCATGCACTTCCAGGCCCTG No data
Right 1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197749966 Original CRISPR TATCTCGGAGCCGCAGCCCC GGG Intergenic
No off target data available for this crispr