ID: 1197753239

View in Genome Browser
Species Human (GRCh38)
Location X:129979894-129979916
Sequence CACTGAGGTCGCCCAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197753231_1197753239 4 Left 1197753231 X:129979867-129979889 CCTCGGAGCTTGAGCGCCAGAAC No data
Right 1197753239 X:129979894-129979916 CACTGAGGTCGCCCAGGGTGGGG No data
1197753230_1197753239 14 Left 1197753230 X:129979857-129979879 CCGCGGGCGGCCTCGGAGCTTGA No data
Right 1197753239 X:129979894-129979916 CACTGAGGTCGCCCAGGGTGGGG No data
1197753229_1197753239 15 Left 1197753229 X:129979856-129979878 CCCGCGGGCGGCCTCGGAGCTTG No data
Right 1197753239 X:129979894-129979916 CACTGAGGTCGCCCAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197753239 Original CRISPR CACTGAGGTCGCCCAGGGTG GGG Intergenic
No off target data available for this crispr