ID: 1197753413

View in Genome Browser
Species Human (GRCh38)
Location X:129980425-129980447
Sequence ACGGTGCGGCCCTGCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197753395_1197753413 17 Left 1197753395 X:129980385-129980407 CCAGGTAAAGGGGGCGCCGTGAG No data
Right 1197753413 X:129980425-129980447 ACGGTGCGGCCCTGCGGCGGGGG No data
1197753394_1197753413 18 Left 1197753394 X:129980384-129980406 CCCAGGTAAAGGGGGCGCCGTGA No data
Right 1197753413 X:129980425-129980447 ACGGTGCGGCCCTGCGGCGGGGG No data
1197753405_1197753413 1 Left 1197753405 X:129980401-129980423 CCGTGAGGCGGGGGTGGTGGGGG No data
Right 1197753413 X:129980425-129980447 ACGGTGCGGCCCTGCGGCGGGGG No data
1197753389_1197753413 30 Left 1197753389 X:129980372-129980394 CCGGGGGCTCTGCCCAGGTAAAG No data
Right 1197753413 X:129980425-129980447 ACGGTGCGGCCCTGCGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197753413 Original CRISPR ACGGTGCGGCCCTGCGGCGG GGG Intergenic