ID: 1197755730

View in Genome Browser
Species Human (GRCh38)
Location X:129993042-129993064
Sequence CCTGCTGAAGACCAAGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197755730 Original CRISPR CCTGCTGAAGACCAAGATTG AGG Intronic
900997779 1:6131733-6131755 CCTGCAGATGACCAAGATGCTGG - Exonic
901276114 1:7992140-7992162 ACTGCTGAAGCCCAAATTTGAGG - Intergenic
901403308 1:9029438-9029460 GAGGCTGAAGTCCAAGATTGAGG - Intergenic
901675154 1:10879000-10879022 CCGGCTGCAGACCCAGAATGTGG + Intergenic
903019141 1:20381404-20381426 CCAGCTGGAAACCAAGATGGCGG + Intergenic
903154419 1:21434429-21434451 CCTGCTGCAGACCCAGCTGGAGG + Intergenic
904420918 1:30390787-30390809 CCTGCTGAAGAACAGCATAGTGG - Intergenic
904702820 1:32368272-32368294 CCTGCTGATGACCAATGTTGTGG + Intronic
905124454 1:35707488-35707510 CCTGCTGGAGACGGAGGTTGGGG + Intergenic
905241376 1:36583647-36583669 CTCCCTGAAGACAAAGATTGGGG + Intergenic
905594617 1:39195343-39195365 ACTGCTTAAGAGCAAGAATGGGG - Intronic
907499878 1:54871311-54871333 GCTGCTGCTGACCAAGACTGGGG - Intronic
911327429 1:96484630-96484652 CCTTCTGGTGACAAAGATTGAGG - Intergenic
916417572 1:164607002-164607024 GTTGCTGAAGAGCAAGTTTGTGG + Intronic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
918239004 1:182605413-182605435 CCTGCTGAAGACCCAGCTGCAGG + Intergenic
919773479 1:201178027-201178049 CCTGCTGAAGACAGGGATGGTGG + Intergenic
920987158 1:210901533-210901555 AGTGATGCAGACCAAGATTGGGG + Intronic
921010326 1:211134253-211134275 CCTGCGGGAGACCAAGCTGGGGG + Intergenic
923627359 1:235624988-235625010 CCTGCTGAGGACCCACACTGAGG + Intronic
923966523 1:239146890-239146912 CCTCCTGATCACCAAGATTTGGG - Intergenic
924573117 1:245256224-245256246 CCTGCTGCAGACCAGGAATATGG + Intronic
1063424077 10:5937811-5937833 ACTGCTGGAGCCCAAGGTTGAGG + Intronic
1066413182 10:35193535-35193557 CCTGCTGGAGCCCCAGATTGAGG + Intronic
1070976436 10:80609405-80609427 CCTGCTGAAGAGAAAGAAAGTGG - Exonic
1072547484 10:96450760-96450782 CCTGATGCAGACAAAGACTGAGG + Intronic
1074497274 10:113991216-113991238 ACTGCTGAAAACCATAATTGTGG + Intergenic
1080427962 11:32173457-32173479 CCTGCTGAAGAACTGGAATGAGG + Intergenic
1080763570 11:35275568-35275590 CATGGTGAAAACCAAGATTCTGG - Intronic
1083342250 11:61966529-61966551 ACTGCCTAAGACCAAGATTTGGG + Intronic
1084898808 11:72294574-72294596 CCTGCTGGAGCCTAAGGTTGGGG - Intronic
1085117065 11:73938829-73938851 ACTGCTGAAGAAAAAGAATGGGG + Intergenic
1085878923 11:80442370-80442392 CATGCTGAGGGCAAAGATTGAGG - Intergenic
1095277896 12:40311193-40311215 ACTGCTGAAAACCAAGTTAGTGG - Intronic
1096669132 12:53187898-53187920 CCAGCTGGAGTCCAAGGTTGTGG - Exonic
1099251241 12:80257603-80257625 GCTGCTGAAGACCAGGAAGGAGG + Intronic
1099516401 12:83601362-83601384 CTTCCTGAAGACCCAGATTGTGG + Intergenic
1101299901 12:103468595-103468617 CCTGTTAAACACCAAGAATGGGG - Intronic
1101924008 12:108956356-108956378 CCTGCTGAGCATCATGATTGGGG - Intronic
1103845765 12:123901118-123901140 CATGCTGAGGAGCAAAATTGTGG - Intronic
1103896904 12:124279012-124279034 CCTGATGAGGACCAAGGTGGCGG - Intronic
1104218710 12:126760953-126760975 CCTGATGCAGAGGAAGATTGAGG - Intergenic
1105981145 13:25517737-25517759 CCTGCTGTAGACTAAGAATTAGG + Intronic
1107108972 13:36675044-36675066 CTTGTTGAGGACCAGGATTGGGG + Intronic
1112813173 13:103242741-103242763 CCTGCTGAAGAAGAAGATACAGG - Intergenic
1112935157 13:104788172-104788194 CCCGCTGAACACCAAAATTCTGG - Intergenic
1113894802 13:113757001-113757023 GATGTTGAAGACCAAGCTTGAGG - Intergenic
1118915853 14:70104363-70104385 CCTGATAAAGATAAAGATTGTGG + Intronic
1119191991 14:72689187-72689209 TCTGCTGAAGACAAAGCTGGGGG + Intronic
1119545588 14:75469319-75469341 AGAGCTGAAGACCCAGATTGAGG + Exonic
1121696802 14:95920233-95920255 CCTCCTGAAAACCATTATTGTGG - Intergenic
1121961522 14:98264538-98264560 CCTGCTGAACACCTTGATTGTGG + Intergenic
1202844822 14_GL000009v2_random:159051-159073 CCTGAGGATGACCAAGATTTGGG + Intergenic
1202914222 14_GL000194v1_random:149298-149320 CCTGAGGATGACCAAGATTTGGG + Intergenic
1123492022 15:20788447-20788469 AGTGCAGAAGACCAAGGTTGGGG + Intergenic
1123548526 15:21357537-21357559 AGTGCAGAAGACCAAGGTTGGGG + Intergenic
1123832906 15:24160004-24160026 GATGCCAAAGACCAAGATTGAGG + Intergenic
1123839629 15:24234907-24234929 GATGCCAAAGACCAAGATTGAGG + Intergenic
1123849496 15:24340703-24340725 GATGCCAAAGACCAAGATTGAGG + Intergenic
1123852691 15:24376666-24376688 GATGCCAAAGACCAAGATTGAGG + Intergenic
1125919465 15:43517134-43517156 ACTGCTTAAGACAAAGGTTGGGG - Intronic
1126336626 15:47592087-47592109 ACTGCTGGAGACCTAGATTAGGG - Intronic
1127135009 15:55910957-55910979 CATGCTGAAGACAAAGAAGGGGG - Intronic
1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG + Intergenic
1202956860 15_KI270727v1_random:84768-84790 AGTGCAGAAGACCAAGGTTGGGG + Intergenic
1132603374 16:783700-783722 CCTCCAGAAGACCCAGATCGGGG - Intergenic
1134071650 16:11263863-11263885 CCTGCTGGAGACCCAAATTCAGG - Intronic
1136485008 16:30565968-30565990 CCTGCTGCAGACCGATACTGAGG - Intergenic
1136646530 16:31624047-31624069 CCGGCTGAAGCCCAAGATCAAGG + Intergenic
1138381795 16:56607796-56607818 CTTCCTGAGGACCAAGCTTGTGG + Intergenic
1138382358 16:56611368-56611390 CTTCCTGAGGACCAAGCTTGTGG + Intergenic
1141426129 16:83945906-83945928 CCTGCTGATGACCCTGGTTGGGG - Intronic
1142698534 17:1646338-1646360 CCTGATGCAGGCCAGGATTGGGG + Exonic
1143610220 17:8013788-8013810 ACTGTTGAAGACCAAGATGTGGG - Intronic
1144323831 17:14157764-14157786 ACTGCTGCAGCCCAAGAGTGTGG - Intronic
1144427428 17:15157039-15157061 CCTGCTTAAGACCAAAATTAAGG + Intergenic
1152009132 17:77700188-77700210 CCTGCTGAAGTCCAAGGTCACGG + Intergenic
1157008017 18:43609790-43609812 CCTGAGCAAAACCAAGATTGTGG - Intergenic
1158938628 18:62386679-62386701 CCAGCTGAAGAGCATGACTGTGG + Exonic
1159894725 18:73985475-73985497 CATGGTCAAGACCAAGGTTGGGG + Intergenic
1160620959 18:80170330-80170352 CATGCTGTAGACCAAGCCTGTGG - Exonic
1163985016 19:20937969-20937991 ACTGCTAAAGCCCAAGATTGAGG - Intronic
1164001302 19:21101904-21101926 TCTGCTAAAGCCCAAGATTGAGG - Intronic
1164008070 19:21170109-21170131 TCTGCTAAAGCCCAAGATTGAGG - Intronic
1164014566 19:21242048-21242070 TCTGCTAAAGCCCAAGATTGAGG + Intronic
1164093721 19:21985464-21985486 TTTGCTAAAGCCCAAGATTGAGG + Intronic
1164103021 19:22075680-22075702 TCTGCTAAAGCCAAAGATTGAGG - Intronic
1164113275 19:22191206-22191228 TTTGCTAAAGCCCAAGATTGAGG + Intronic
1164116386 19:22223250-22223272 TCTGCTAAAGCCCAAGATTGAGG - Intergenic
1164134343 19:22399980-22400002 TCTGCTAATGCCCAAGATTGAGG + Intronic
1164164468 19:22656793-22656815 TCTGCTAATGCCCAAGATTGAGG - Intronic
1164197674 19:22985514-22985536 TTTGCTAAAGCCCAAGATTGAGG + Intronic
1164200080 19:23010718-23010740 TCTCCTAAAGCCCAAGATTGAGG - Intergenic
1164215214 19:23138674-23138696 TCTGCTAATGCCCAAGATTGAGG - Intronic
1164739486 19:30565815-30565837 CCAGCTGAACACCAGGAGTGAGG + Intronic
1164973095 19:32549212-32549234 CTTGCTGAGGACCAAGAGAGTGG + Intergenic
1165230126 19:34381617-34381639 CCTGCTGCATACCTAGCTTGGGG + Intronic
1167468517 19:49662887-49662909 CCTGCTGAGGCCCAAGCTGGGGG - Intronic
929596385 2:43178952-43178974 CCTTCTGAAGACCAAGGTCTGGG + Intergenic
930019681 2:46994043-46994065 CCTGCTGAATACTCAGAGTGGGG + Intronic
932661391 2:73656107-73656129 ACTTCTGGAGACCAAGACTGGGG - Intergenic
934602625 2:95669513-95669535 CATGCTGAAGTCTGAGATTGAGG + Intergenic
935161061 2:100529898-100529920 CCCCCTGAAGACCAAGATCCCGG - Intergenic
935657466 2:105437094-105437116 CCTGCTGAAAGGCAAGATGGTGG + Intronic
935680777 2:105635214-105635236 CCAGCTGAAGAACAAGATGGGGG + Intergenic
936536001 2:113311705-113311727 CATGCTGAAGTCTGAGATTGAGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
947825630 2:233104484-233104506 CCTGCTAAAGAGCAGGATTTGGG + Intronic
1169915443 20:10678135-10678157 AGTGCTGAAGACCAGTATTGTGG - Intergenic
1170101764 20:12708836-12708858 CCTCCTGAAGACCAGTCTTGAGG - Intergenic
1171285196 20:23931190-23931212 CATGCTGAAGACAAGGGTTGTGG + Intergenic
1173083367 20:39891009-39891031 CCTGAGGAAGACCAAGCTTCAGG + Intergenic
1174660715 20:52210569-52210591 CCCGCCGAAGACCAAGAGAGAGG - Intergenic
1174972999 20:55298577-55298599 CTTGATGAAGAACAAGACTGGGG + Intergenic
1175092160 20:56513377-56513399 CGTGCTGAAGACAAGGATGGAGG + Exonic
1176446602 21:6827386-6827408 AGTGCAGAAGACCAAGGTTGGGG - Intergenic
1176633576 21:9163973-9163995 CCTGAGGATGACCAAGATTTGGG + Intergenic
1176824772 21:13692416-13692438 AGTGCAGAAGACCAAGGTTGGGG - Intergenic
1177406677 21:20677069-20677091 CCAGATGAAGACCTAGATAGTGG - Intergenic
1178432588 21:32529628-32529650 CCCTCTGAAGACCAAGAAGGGGG - Intergenic
1179062908 21:37996044-37996066 CCTGCTGAAGTCCAGCAGTGTGG - Intronic
1179190054 21:39115867-39115889 CCTGCTGGAGTCCAGGGTTGGGG - Intergenic
1179540994 21:42083234-42083256 CCTGGTGTAGACCAGGAGTGTGG - Intronic
1182036601 22:27203375-27203397 TCTGCTGAATAACAAGAGTGAGG + Intergenic
1182449060 22:30407537-30407559 CCTGCTGAGGACCAAGATGCGGG + Exonic
1182457522 22:30461415-30461437 TTTCCTGAAGACCAAGATGGGGG - Exonic
1182458555 22:30468552-30468574 CCTGCTCAAGACCAAGATGAGGG - Exonic
1182462340 22:30491678-30491700 TTTCCTGAAGACCAAGATGGGGG - Exonic
1182467306 22:30525455-30525477 TTTCCTGAAGACCAAGATGGGGG - Exonic
949650129 3:6148516-6148538 CCTTCTGACCACCAAGATTTTGG + Intergenic
949705972 3:6817328-6817350 GCTGCAGTAGACCAAGACTGAGG + Intronic
952214700 3:31266365-31266387 CCTGGTGAGCACCCAGATTGAGG - Intergenic
954303604 3:49714128-49714150 TCTGCTGAAAACCAAACTTGAGG + Exonic
957100446 3:75819969-75819991 CCTGAGGATGACCAAGATTTGGG + Intergenic
963428870 3:145170058-145170080 CCTACTGAAAAACAAGATCGCGG - Intergenic
966567247 3:181396847-181396869 CCTGATGAAGCCCAAGACTGGGG - Intergenic
967383272 3:188883980-188884002 CATGGGGAAGACCATGATTGTGG + Exonic
969471216 4:7390463-7390485 CCTGGTAAAGACGAAGCTTGGGG + Intronic
969722092 4:8897768-8897790 CCAGCTGAAGAACACGAGTGAGG - Intergenic
973647178 4:52961399-52961421 ACTCCTGAGGACAAAGATTGAGG + Intronic
974865077 4:67570106-67570128 CCTCCTGAAGAACATGCTTGAGG + Intronic
975321125 4:73011364-73011386 CCTCCTGATGGCCAAGACTGGGG + Intergenic
978375841 4:108074874-108074896 CCTGCTGAATACAGAGAGTGAGG - Intronic
980482695 4:133408634-133408656 GCTGCTGACCACCCAGATTGAGG - Intergenic
980749399 4:137069795-137069817 CTTGCTCAACACCAAGGTTGTGG + Intergenic
980866507 4:138559632-138559654 TCTGGTAAAAACCAAGATTGTGG - Intergenic
982867297 4:160530727-160530749 CCTCATGATGACCAAGATTTTGG - Intergenic
984861994 4:184249222-184249244 CCTTTTGAAGACAAAGATTACGG + Intergenic
988455293 5:31381964-31381986 GCTGCTGAAGACAAAGAGTGTGG + Intergenic
989146871 5:38258307-38258329 CCCGCTGGTGACCTAGATTGGGG - Intergenic
1000549887 5:162647840-162647862 CCTTCTGAATATCAGGATTGAGG + Intergenic
1000880023 5:166686541-166686563 CCTACTGAATACCCAGATTTGGG - Intergenic
1003567226 6:7231339-7231361 CCTGCTGAAAACCAAGGTGGCGG + Exonic
1005081171 6:21958110-21958132 CATGGTGATGACCAAGACTGGGG + Intergenic
1008771445 6:54983420-54983442 CCCGCTGAAGACCAAAAGAGAGG - Intergenic
1012792539 6:103715187-103715209 CCAGGTGAAGAACAAGATTCAGG - Intergenic
1014905877 6:127026200-127026222 CCTGATCAAGGCCAATATTGAGG + Intergenic
1016620343 6:146102179-146102201 CCTGGTGAGGAGCCAGATTGAGG - Intronic
1016873138 6:148838452-148838474 TCAGCTGAAGACCATGATTCAGG + Intronic
1025816784 7:64920700-64920722 TCTGCTAAAGCTCAAGATTGAGG - Intronic
1025860837 7:65326079-65326101 CCTGCAAAAGCCCAAGACTGAGG - Intergenic
1028707278 7:93864745-93864767 CCTGATGAAGACTAAGATTCAGG + Intronic
1030112544 7:106038996-106039018 CCCGCTGCAGACCAAGCATGGGG - Intergenic
1031133111 7:117856055-117856077 CCTGCTGAAGTCCAAGAGGGAGG - Intronic
1031154003 7:118087321-118087343 CCCGCTGAAAACTCAGATTGGGG - Intergenic
1031350535 7:120725140-120725162 CCTGCTGAAATCCCACATTGAGG + Intronic
1031461730 7:122059127-122059149 CCTGTTGAAGACAGAGAATGGGG + Intronic
1037819454 8:22128714-22128736 CCTTCTGGAGACCAAGATCCTGG - Exonic
1043506949 8:80911578-80911600 CCCTCTGAAGACCAAGAGAGAGG - Intergenic
1044642196 8:94395049-94395071 CATGATGATGACAAAGATTGGGG + Intronic
1047135309 8:122071275-122071297 CCCGCTGAAGACCAAGAGAGAGG + Intergenic
1049483485 8:142839267-142839289 CATGCAGGAGACCAAGACTGGGG - Intronic
1050761208 9:9073548-9073570 TTTGCTGAAGGCCAAGACTGAGG + Intronic
1060260052 9:122066558-122066580 CATGCTAAAAACCAAGTTTGGGG + Intronic
1203522588 Un_GL000213v1:57145-57167 AGTGCAGAAGACCAAGGTTGGGG + Intergenic
1203756415 Un_GL000218v1:131598-131620 CCTGAGGATGACCAAGATTTGGG + Intergenic
1186359141 X:8821303-8821325 CCTGCTGAAGGCCAGTTTTGGGG - Intergenic
1186750759 X:12619484-12619506 CCTGGTGGAGCCCAAGACTGAGG + Intronic
1188791686 X:34413768-34413790 CCTGCTGAAGAGTAAGGGTGAGG - Intergenic
1191899700 X:66028080-66028102 GCTACTCAAGACCAAGACTGAGG - Exonic
1195196500 X:102502335-102502357 CCTGCTGGAGACAAAGAGTTAGG - Intergenic
1196672555 X:118384442-118384464 CCTGATGAAAACAAAGAATGGGG - Intronic
1197755730 X:129993042-129993064 CCTGCTGAAGACCAAGATTGAGG + Intronic
1197849650 X:130844061-130844083 CAGGCTGAAGGCAAAGATTGTGG - Intronic
1198156541 X:133966373-133966395 AATGCTGAAGACCAGGATGGGGG - Intronic
1199559840 X:149150950-149150972 CCTGGTGAAGAGCAAGAGGGTGG + Intergenic
1201017564 Y:9622042-9622064 CAGGTTGAAGACCAAGATTTGGG - Intergenic
1201794185 Y:17876882-17876904 CCTGCAGAAGAGAAAGCTTGTGG + Intergenic
1201807369 Y:18029103-18029125 CCTGCAGAAGAGAAAGCTTGTGG - Intergenic
1202093735 Y:21221760-21221782 CCTGCTCAAGACCAAGAACTTGG - Intergenic
1202355568 Y:24044701-24044723 CCTGCAGAAGAGAAAGCTTGTGG + Intergenic
1202515210 Y:25625408-25625430 CCTGCAGAAGAGAAAGCTTGTGG - Intergenic