ID: 1197755869

View in Genome Browser
Species Human (GRCh38)
Location X:129994242-129994264
Sequence ACCCATAGCCTACACTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197755869_1197755871 1 Left 1197755869 X:129994242-129994264 CCACCGCAGTGTAGGCTATGGGT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1197755871 X:129994266-129994288 CTAGAGTATATCACTTTTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 137
1197755869_1197755872 19 Left 1197755869 X:129994242-129994264 CCACCGCAGTGTAGGCTATGGGT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1197755872 X:129994284-129994306 CAAGGCATTACTTGATTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197755869 Original CRISPR ACCCATAGCCTACACTGCGG TGG (reversed) Intronic
901313017 1:8284180-8284202 ACAAATATCCTACACTGCTGTGG - Intergenic
921300681 1:213748952-213748974 TTTCATAGCCAACACTGCGGAGG - Intergenic
1076288916 10:129328988-129329010 AAAAATAGCCCACACTGCGGAGG + Intergenic
1079522403 11:21343561-21343583 ACCCATGGCCTAGACTGTTGTGG - Intronic
1082797459 11:57388434-57388456 ACCCACAGACAACACTGAGGGGG - Intronic
1083518531 11:63283771-63283793 ACCCTTTTCCTACACTGCGGAGG + Intronic
1096677319 12:53232608-53232630 CCCCATTGCCTACCCTGGGGAGG - Intronic
1115756962 14:36538065-36538087 TCCCATAGCTTACACTGGGCTGG - Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG + Intronic
1135487136 16:22875665-22875687 ACACTTAGGCCACACTGCGGTGG - Intronic
1137651805 16:50126970-50126992 ATCCATAGACTACATTGCAGGGG + Intergenic
1142135229 16:88448958-88448980 AGCCACAGCAGACACTGCGGAGG - Intergenic
1142235109 16:88918384-88918406 AGCCACAGCCCACACTGCGAAGG - Intronic
1144013434 17:11171695-11171717 ACCCATACCCTACTGTGTGGTGG + Intergenic
1157812176 18:50705088-50705110 ACCCATACCCCACACGGCAGAGG + Intronic
1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG + Intronic
1160771550 19:834118-834140 TCCCCTAGCCTGCAGTGCGGTGG - Intergenic
1161708624 19:5834464-5834486 ACCCAGTGCCCACACTCCGGGGG - Intronic
1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG + Intronic
1164815694 19:31200780-31200802 ACCAACAGCCCACACTGTGGTGG - Intergenic
930968280 2:57359494-57359516 CACCAGAGCCTACACTGGGGTGG - Intergenic
934876808 2:97929188-97929210 ACCCAAATCCTACACTGATGGGG + Intronic
938207930 2:129439587-129439609 GCCCATGGCCCACACTGAGGAGG - Intergenic
939184374 2:138843011-138843033 AGCCATATCCTACATTGCTGGGG + Intergenic
944937033 2:204580099-204580121 ACCCATAGTCTAGACTCTGGAGG + Intronic
1176675249 21:9771630-9771652 ACGCCTGGCCTGCACTGCGGAGG + Intergenic
1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG + Intronic
1182091259 22:27596526-27596548 ACTCAAAGCCTCCACTGTGGTGG + Intergenic
1184740726 22:46427627-46427649 AACCATTGCCAACAGTGCGGTGG - Intronic
1185343249 22:50300725-50300747 ACCCAGAGCCCAGACTGCAGGGG - Intronic
951502983 3:23411176-23411198 ACCCACAGCCTCAACTGAGGCGG - Intronic
953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG + Intronic
968497798 4:927845-927867 ACCCAGAGCCTGAAGTGCGGTGG - Intronic
972355083 4:38272983-38273005 ACACATTGCATACACTGCAGAGG - Intergenic
974525906 4:63049881-63049903 AACCACAGCCTACCCTGCTGTGG - Intergenic
985400302 4:189587067-189587089 ACGCCTGGCCTGCACTGCGGAGG - Intergenic
991523059 5:67522454-67522476 AAGCATAGCCTACATTGCTGTGG - Intergenic
992364093 5:76074091-76074113 AGCCAGAGCCTTCACTGCAGAGG - Intergenic
996526418 5:124484974-124484996 CCCCAGAGCCTAGACTGCAGAGG + Intergenic
999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG + Intronic
1002782386 6:377356-377378 CCCCAAAGCCCACACTGGGGAGG + Intergenic
1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG + Intronic
1006416256 6:33905847-33905869 TCCCTTAGCCTTCCCTGCGGTGG + Intergenic
1030818950 7:114073269-114073291 ACCCAAAGCCAATACTGAGGAGG + Intronic
1034669627 7:152848250-152848272 GCCCCTCTCCTACACTGCGGTGG + Intronic
1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG + Intronic
1041768809 8:61450428-61450450 ACTCACATCCTACACTGCTGAGG - Intronic
1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG + Intergenic
1051608864 9:18942432-18942454 ACCCAACCCCTTCACTGCGGAGG + Intronic
1062393589 9:136343608-136343630 GCCCACAGCCTAAACTGCAGGGG - Intronic
1194532478 X:95068715-95068737 ACCAATGTCCTACACTGCTGTGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1202023309 Y:20491488-20491510 ACCCATATCCTATCCTGCTGTGG - Intergenic