ID: 1197755871

View in Genome Browser
Species Human (GRCh38)
Location X:129994266-129994288
Sequence CTAGAGTATATCACTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197755864_1197755871 11 Left 1197755864 X:129994232-129994254 CCAAGTTTTCCCACCGCAGTGTA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1197755871 X:129994266-129994288 CTAGAGTATATCACTTTTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 137
1197755869_1197755871 1 Left 1197755869 X:129994242-129994264 CCACCGCAGTGTAGGCTATGGGT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1197755871 X:129994266-129994288 CTAGAGTATATCACTTTTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 137
1197755867_1197755871 2 Left 1197755867 X:129994241-129994263 CCCACCGCAGTGTAGGCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1197755871 X:129994266-129994288 CTAGAGTATATCACTTTTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 137
1197755870_1197755871 -2 Left 1197755870 X:129994245-129994267 CCGCAGTGTAGGCTATGGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1197755871 X:129994266-129994288 CTAGAGTATATCACTTTTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197755871 Original CRISPR CTAGAGTATATCACTTTTCA AGG Intronic
903615439 1:24651195-24651217 CTCGAGTATATCAGTTATAAGGG - Intronic
903641249 1:24861933-24861955 CTAGAGAATATGACTTGTCCTGG + Intergenic
909758856 1:79264302-79264324 CTAGAATCTATCATATTTCAAGG - Intergenic
910615163 1:89189581-89189603 CTAGAGAAAACCACTTTTAAGGG - Intronic
912571465 1:110627205-110627227 ATAGATTATGTCACTTTCCAAGG - Intronic
914508957 1:148314287-148314309 CTGGAGTATATTAATTGTCATGG - Intergenic
916338461 1:163700184-163700206 CTTTAGTATATCACTTTCCCAGG + Intergenic
916884118 1:169050588-169050610 CTAGGGTTTATATCTTTTCAAGG - Intergenic
918638166 1:186804817-186804839 TCAGAGTATATGACTCTTCAAGG + Intergenic
921036787 1:211387155-211387177 CCAGAGTATTTCACTTCTGAGGG - Intergenic
921036796 1:211387228-211387250 CCAGAGTATTTCACTTGTGAGGG - Intergenic
1064386948 10:14903644-14903666 ATAGAATATATTAGTTTTCAAGG + Intronic
1067155548 10:43778721-43778743 CTAGAGTAGATCTCATTTCCGGG + Intergenic
1067780277 10:49197429-49197451 TTAAAGTTTATCTCTTTTCATGG - Intergenic
1068562404 10:58530085-58530107 CTAGATTATATTCCTTTTAAAGG - Intronic
1070568670 10:77623747-77623769 CTATAGTTTAACTCTTTTCAGGG - Intronic
1070869249 10:79735006-79735028 CTAGAATATATTACTCTTCATGG - Intergenic
1071636166 10:87257193-87257215 CTAGAATATATTACTCTTCATGG - Intergenic
1071659074 10:87480750-87480772 CTAGAATATATTACTCTTCATGG + Intergenic
1073602248 10:104858038-104858060 TTAAAGTATCTCAATTTTCATGG - Intronic
1075883092 10:125871731-125871753 TTTGAGTATTTCACATTTCAAGG + Intronic
1076578178 10:131485677-131485699 CAAGAGATTATCACTTTTTAAGG + Intergenic
1079553488 11:21730458-21730480 CTAGAATATACCACCTTCCAAGG + Intergenic
1082226686 11:49715971-49715993 GTAGATTATTTGACTTTTCAGGG - Intergenic
1084822101 11:71699114-71699136 CTAAATTATATCACTTTCCTGGG - Intergenic
1086622739 11:88907110-88907132 GTAGATTATTTGACTTTTCAGGG + Intronic
1086981498 11:93203385-93203407 CTAGAGTGTCACACTTTTCTAGG - Intergenic
1089110769 11:116054169-116054191 CTGGTGTCTTTCACTTTTCAGGG + Intergenic
1089464690 11:118677381-118677403 CTAGAATATTTCACCTTTGATGG + Intronic
1089930233 11:122302931-122302953 CTAGCGTGCATTACTTTTCAAGG - Intergenic
1092745690 12:11670135-11670157 AGAGATTATATCAGTTTTCATGG + Intronic
1095925341 12:47573510-47573532 CTAGACTATACCTCTTTCCATGG + Intergenic
1096066851 12:48747860-48747882 CTGGAGCACAACACTTTTCATGG - Intergenic
1097404125 12:59167927-59167949 CTAGAGTATCTCATTTTTTTCGG - Intergenic
1100683116 12:96951564-96951586 CTAAAATATATTACCTTTCATGG - Intronic
1100765068 12:97854952-97854974 CTTGTGTATGTGACTTTTCATGG + Intergenic
1102090388 12:110182476-110182498 CTAGAGTCTCACACTTCTCAAGG - Intronic
1109133367 13:58616173-58616195 GTAGAGAAGATAACTTTTCATGG + Intergenic
1112586365 13:100722370-100722392 CTAGAACATATTTCTTTTCAGGG + Intergenic
1116690667 14:48101979-48102001 TTAGAGCATATCAATTTCCATGG - Intergenic
1116941938 14:50799123-50799145 ATAGACTATAACACTTTCCATGG + Intronic
1118760252 14:68876628-68876650 CCAGAGTAGATCACTGCTCAGGG + Intronic
1119797764 14:77414638-77414660 CAAAAGTATAACCCTTTTCAAGG + Intronic
1123832203 15:24151781-24151803 ATATAGTCTATCAGTTTTCAAGG + Intergenic
1124389107 15:29237841-29237863 CTTGGGTATATCACTTTTAATGG - Intronic
1127925780 15:63539599-63539621 CTAAAGTATATGTCGTTTCATGG + Intronic
1128439515 15:67691646-67691668 CAAGAGCATACCACTTTTGATGG - Intronic
1139868246 16:70081302-70081324 TTAGAGCTTATCACGTTTCATGG + Intergenic
1140387087 16:74550548-74550570 TTAGAGCTTATCACGTTTCATGG - Intronic
1143379720 17:6488479-6488501 ATAGAGTTTACCAGTTTTCAGGG + Intronic
1147010054 17:37438550-37438572 CTAGTGTATATAACCTTTCTTGG + Intronic
1150438097 17:65169649-65169671 CTAGTCTATGTCACTTTGCAAGG - Intronic
1150673015 17:67218412-67218434 CTAAAGTAGAACAGTTTTCAAGG + Intronic
1153559780 18:6360439-6360461 CTAGAGGTTTTCACTTTTCTAGG + Intronic
1155312234 18:24535121-24535143 ACAGAGTATATCAATTTTCTAGG - Intergenic
1156570966 18:38252677-38252699 ATAGACTATATGACCTTTCAAGG + Intergenic
1159414198 18:68123257-68123279 CTTGAGTATTCCAATTTTCATGG - Intergenic
1165382210 19:35489502-35489524 CTAGAGTTTTACATTTTTCAGGG - Intronic
925170358 2:1746371-1746393 CTAGAGGACATCACTTTTGCAGG + Intergenic
926729343 2:16024269-16024291 TTAGAATTTATCATTTTTCAGGG - Intergenic
927379359 2:22460549-22460571 CTCTATTATAGCACTTTTCAGGG + Intergenic
929054560 2:37864643-37864665 ACAGCGTATATCAGTTTTCAAGG + Intergenic
929164943 2:38872787-38872809 CTACAGTACCTCACTTTTAATGG + Intronic
929939609 2:46323164-46323186 CTAGATTTTTACACTTTTCAAGG - Intronic
931990287 2:67783287-67783309 CTAAAGTGTATCTCCTTTCAAGG - Intergenic
932700649 2:73989049-73989071 CTAGGGTATACCACATTTAACGG + Intronic
933073952 2:77898753-77898775 ATACAGTATATCTCTTTTCAAGG - Intergenic
933151196 2:78917264-78917286 CTAGAGTAATTCACCTTACATGG + Intergenic
935898960 2:107769998-107770020 CTAGAGAATATCTCTCTTGAAGG + Intergenic
937081855 2:119145949-119145971 TTAGAGCAGATCACTTTCCAGGG - Intergenic
937271993 2:120658951-120658973 TCAGAGTATGTAACTTTTCAGGG - Intergenic
937899833 2:127011380-127011402 CTAGACTATAGCACTACTCAGGG + Intergenic
939612122 2:144324341-144324363 CTAGAGCATATCATTTTAAAAGG - Intronic
942978750 2:182052445-182052467 CTTGATTATTTCACTTATCAAGG - Intronic
1172322794 20:34009838-34009860 CCAGAGTATAGCACTTTTTTTGG + Intronic
1183558669 22:38552307-38552329 CTAGAATCTTTCACTTTCCATGG - Intronic
952218410 3:31300551-31300573 CAAGAGTATTCCCCTTTTCAGGG - Intergenic
962823093 3:139071635-139071657 ATAGAGTAAATCAGTTTCCAAGG - Intronic
963272377 3:143298626-143298648 CTGAACTATTTCACTTTTCATGG + Intronic
966978536 3:185107828-185107850 CTAGAGTCTATGACTATTAAAGG - Intronic
967189271 3:186971673-186971695 CTATAAAATATCACTTTTCATGG - Intronic
967605386 3:191439077-191439099 CTAGAATATAAAACATTTCAGGG + Intergenic
972024096 4:34354789-34354811 CCAGAGTATATCACTATACATGG + Intergenic
974152775 4:58030516-58030538 TTAGAGTAGAAAACTTTTCAAGG + Intergenic
974332599 4:60499436-60499458 CTTGACTATATCAGTTTTCTAGG + Intergenic
975852399 4:78585710-78585732 GTAGTGTATATGACTTTTCTTGG + Intronic
977512457 4:97978686-97978708 ATACAGTGTATAACTTTTCAAGG + Intronic
978493303 4:109332337-109332359 TTAGAGTTTATAATTTTTCAGGG + Intergenic
979830339 4:125292919-125292941 ATACAGTATATACCTTTTCAGGG - Intergenic
980259506 4:130430213-130430235 AAAGAGTATTTCATTTTTCAAGG - Intergenic
982362820 4:154540358-154540380 CGTGAGAATATCACATTTCAGGG + Intronic
985073871 4:186193254-186193276 CTTCAGTATATTACTTTCCAGGG - Intronic
986897855 5:12392687-12392709 CTAGAGAATAGGACTTTCCATGG + Intergenic
988513078 5:31882111-31882133 CTAGAGTTTATCAGTTATGATGG - Intronic
990082801 5:51937701-51937723 CCAGAGGATTTCACTTTCCAGGG - Intergenic
990225619 5:53649136-53649158 CTAGAGTATCCCCCTGTTCATGG + Intronic
990611974 5:57466710-57466732 CTGGAGTATGTCACTTTTTCAGG + Intergenic
991304249 5:65159932-65159954 CTAGATTATATTACTTTTAATGG - Intronic
992617290 5:78557093-78557115 CAAGAGTATACCAGTGTTCAAGG + Intronic
994416214 5:99475244-99475266 ATAGAGGACATAACTTTTCAGGG - Intergenic
994463755 5:100099928-100099950 ATAGAGGACATAACTTTTCAGGG + Intergenic
994938562 5:106289220-106289242 CTAAAGTCTATCATGTTTCACGG + Intergenic
995328747 5:110922421-110922443 CTAGAGTGTGTCACTTTTTAAGG + Intergenic
999397073 5:151236386-151236408 GGAGAGTAGATCTCTTTTCATGG - Intronic
1004148839 6:13095323-13095345 ACAGAGCATATTACTTTTCAGGG + Intronic
1010601156 6:77827988-77828010 TTATAGTATTTAACTTTTCAAGG + Intronic
1012371200 6:98509331-98509353 CTTCAGTATATGATTTTTCAGGG + Intergenic
1012473956 6:99601529-99601551 CCAGAGTCTCTCACTTTTCCTGG + Intergenic
1014523776 6:122476769-122476791 CTAAAACATTTCACTTTTCAAGG + Intronic
1014709305 6:124787685-124787707 CAAAAGTATAACATTTTTCATGG - Intronic
1014837960 6:126182200-126182222 GTAAAGAATATGACTTTTCAGGG + Intergenic
1017075795 6:150616754-150616776 GTAGTGCATATTACTTTTCAGGG - Intronic
1018338644 6:162824792-162824814 CTAGAATAGATCACTATTCAAGG + Intronic
1019868352 7:3734472-3734494 CTAAAGTACATCCCTTTTCAAGG - Intronic
1021086285 7:16423975-16423997 CCAGAGGAGTTCACTTTTCAGGG - Intergenic
1027928410 7:84498110-84498132 CTAGAGTGTATCAGTCTGCAGGG - Intergenic
1029851648 7:103467527-103467549 CTAGAAAATATAACTTTTCATGG - Intergenic
1030901306 7:115127943-115127965 TTAGAGACTATCACTTTTAAAGG + Intergenic
1031345133 7:120656167-120656189 CTAGCCCATATCCCTTTTCATGG + Intronic
1031594963 7:123639767-123639789 CTAGAGTATGTCACTTTATCCGG + Intergenic
1032813498 7:135447353-135447375 CTATAGTATATGAATATTCATGG - Intronic
1032990685 7:137391573-137391595 AAAGAGTTTATCACTTTTGACGG + Intronic
1033993918 7:147321782-147321804 CTAGAGTATCCCAGTCTTCAAGG + Intronic
1037867514 8:22457757-22457779 CTAGAGCATATGATTCTTCAAGG + Intronic
1037923034 8:22821283-22821305 CCAGAGTATTGCAGTTTTCAGGG - Intronic
1038959279 8:32500635-32500657 ATTGAGTATTTCAATTTTCATGG - Intronic
1043256240 8:78140680-78140702 CTAGAGTATATCCCTTTTGAAGG + Intergenic
1044520407 8:93192961-93192983 CTAAACTATATCTCTTTCCAAGG - Intergenic
1046260638 8:111763213-111763235 ATAGAGTACATAACTTTTCTTGG - Intergenic
1046374932 8:113365133-113365155 CAAGAGTTTATGACTTTTCATGG + Intronic
1047471347 8:125176421-125176443 CTGGAGGATATCACATTTTAAGG - Intronic
1050342975 9:4659305-4659327 CTTGAGCATGTCACTTTTAAAGG - Intronic
1052113693 9:24622022-24622044 CTAGAATAAAGAACTTTTCATGG - Intergenic
1056857671 9:90148570-90148592 CAAGACTATAACACTTCTCAAGG - Intergenic
1057915522 9:99052412-99052434 CCAGAGCTCATCACTTTTCACGG + Exonic
1058348672 9:103995459-103995481 CCAGAGTAGATCCCTTCTCAAGG + Intergenic
1059223629 9:112650725-112650747 CGACAGTATCTCTCTTTTCATGG - Intronic
1059898848 9:118899545-118899567 CTAGAGCTTATGAATTTTCAAGG - Intergenic
1186177691 X:6942602-6942624 CAAGTGGATATCACTTTTTAGGG - Intergenic
1186656630 X:11618995-11619017 TTAGAAAATATCAGTTTTCAAGG + Intronic
1187654130 X:21450263-21450285 CTATGGAATATCTCTTTTCAAGG + Intronic
1190003075 X:46708173-46708195 ACAGAGTATATCATTTTTCGTGG - Intronic
1190187296 X:48246455-48246477 TTATAGTATATCACGTTTTAAGG + Intronic
1190656188 X:52614227-52614249 TTATAGTATATCACGTTTTAAGG + Intergenic
1193364555 X:80616158-80616180 CTAAAGAAAATCAATTTTCAAGG - Intergenic
1194051118 X:89070329-89070351 CCAGAGGGTATCAGTTTTCAGGG + Intergenic
1195235390 X:102891870-102891892 GTATAGTGAATCACTTTTCAAGG + Intergenic
1195288767 X:103411206-103411228 GTATAGTGAATCACTTTTCAAGG + Intergenic
1196187084 X:112755830-112755852 CTTGAGTATATCATTTTGAATGG - Intergenic
1197755871 X:129994266-129994288 CTAGAGTATATCACTTTTCAAGG + Intronic
1198430564 X:136562393-136562415 CCAGAGAAAATCACCTTTCATGG - Intergenic
1198880242 X:141273215-141273237 CTAGAGTATTTCAGATGTCAAGG + Intergenic