ID: 1197755872

View in Genome Browser
Species Human (GRCh38)
Location X:129994284-129994306
Sequence CAAGGCATTACTTGATTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197755869_1197755872 19 Left 1197755869 X:129994242-129994264 CCACCGCAGTGTAGGCTATGGGT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1197755872 X:129994284-129994306 CAAGGCATTACTTGATTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 112
1197755867_1197755872 20 Left 1197755867 X:129994241-129994263 CCCACCGCAGTGTAGGCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1197755872 X:129994284-129994306 CAAGGCATTACTTGATTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 112
1197755864_1197755872 29 Left 1197755864 X:129994232-129994254 CCAAGTTTTCCCACCGCAGTGTA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1197755872 X:129994284-129994306 CAAGGCATTACTTGATTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 112
1197755870_1197755872 16 Left 1197755870 X:129994245-129994267 CCGCAGTGTAGGCTATGGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1197755872 X:129994284-129994306 CAAGGCATTACTTGATTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197755872 Original CRISPR CAAGGCATTACTTGATTAGA TGG Intronic
904112676 1:28138783-28138805 GAAGGAATTACTAGATTAAACGG + Intergenic
905307755 1:37031318-37031340 CAAGGCATTGATTGCTTGGATGG - Intronic
907127537 1:52064245-52064267 CAAAGCAATACTTTATTAGAAGG - Intronic
907691884 1:56676978-56677000 CATGGCAGTACTTGATTATAAGG + Intronic
908652510 1:66351377-66351399 CAAGGAGTTACTGGATTGGAAGG - Intronic
908797638 1:67846927-67846949 GAAGGCAGTACTTTTTTAGAAGG + Intergenic
912138478 1:106691704-106691726 AATGGGATTACTTGATTATACGG - Intergenic
912666269 1:111582764-111582786 TAAGGCATTTCCTGTTTAGAGGG + Intronic
913566284 1:120075765-120075787 CAATGAATTACTTACTTAGAAGG - Intergenic
913631846 1:120717786-120717808 CAATGAATTACTTACTTAGAAGG + Intergenic
914286872 1:146235121-146235143 CAATGAATTACTTACTTAGAAGG - Intergenic
914547904 1:148685864-148685886 CAATGAATTACTTACTTAGAAGG - Intergenic
914618605 1:149384481-149384503 CAATGAATTACTTACTTAGAAGG + Intergenic
915070112 1:153259780-153259802 CCAGGCCTGACTAGATTAGATGG + Intronic
919130159 1:193441047-193441069 GAAGGCATTACATAATTAGAGGG - Intergenic
919316098 1:195971850-195971872 CAAGACATTACTTTGTTAGAAGG - Intergenic
1063771139 10:9202447-9202469 AAAGACATTACTTGAATATACGG + Intergenic
1064330860 10:14392671-14392693 CCAAGCATTCCTTGATGAGATGG + Intronic
1069727055 10:70586806-70586828 AAAGGCCTTCCTTGAGTAGAGGG + Intergenic
1071178467 10:82955172-82955194 CATGGCATGACTTCATCAGAAGG + Intronic
1072222460 10:93338302-93338324 CAAGGCATTACTGGCTAAAAGGG - Intronic
1073609641 10:104930465-104930487 CATGGCATTGCTGGACTAGAAGG - Intronic
1073800387 10:107035119-107035141 CAAGAAATTTCTAGATTAGATGG + Intronic
1076503647 10:130957072-130957094 CAAGGCAGAACTTTATTAGCAGG + Intergenic
1079143095 11:17826922-17826944 CAAGGCATTCCTTGCTTATAAGG + Intronic
1081827009 11:46064845-46064867 CAAAGCAATACATTATTAGAAGG - Intronic
1091957445 12:4658962-4658984 CAAAGCTTTACGTGATAAGATGG - Intronic
1094444390 12:30514020-30514042 CAAACCATTACCTGATTTGATGG - Intergenic
1099679696 12:85809878-85809900 TAAGGCATTACTTTTTTAGTAGG - Intronic
1102187493 12:110960363-110960385 CAAGGCAAAACTTGATTATGAGG - Intergenic
1103331484 12:120157396-120157418 CATGGAATTACTAGATTATATGG - Intronic
1106487170 13:30182028-30182050 CAATGCATTACTTAATCAAATGG + Intergenic
1107021840 13:35760098-35760120 CAAGGCATGACATGCTCAGATGG - Intergenic
1108888302 13:55219581-55219603 GAAGGCCTTCCTTAATTAGATGG - Intergenic
1110776850 13:79417686-79417708 TAAGGGTTTACATGATTAGAGGG - Intergenic
1121609340 14:95265308-95265330 TAAGGCTTTAACTGATTAGATGG - Intronic
1126401840 15:48279859-48279881 TAAATAATTACTTGATTAGAAGG + Intronic
1128615486 15:69105689-69105711 CAAAGCATTATTTGATGAGCTGG + Intergenic
1151268462 17:72975080-72975102 TAATGCATGACTTTATTAGAAGG + Intronic
1155379211 18:25200192-25200214 CAAAGCACTACTTAATTATATGG - Intronic
1155505989 18:26533190-26533212 CAATGCATTGCTTGGTAAGAGGG - Intronic
1156971330 18:43160613-43160635 CAAGGCTTTACTTTATAATATGG + Intergenic
1159078230 18:63705533-63705555 TAAGCCATGACTGGATTAGAAGG - Intronic
1160002643 18:75041486-75041508 CAAGGTATTGCTTGTTTAGATGG - Intronic
1162673280 19:12276887-12276909 CAGGGCATTACATGATGAGGGGG - Intronic
930363188 2:50407689-50407711 CAGGGCATCACATGATGAGAGGG - Intronic
930793037 2:55354973-55354995 CAAGGCATTACTAGATGATAGGG + Intronic
931111809 2:59118983-59119005 CAAGGCATTAATTGGTATGAGGG - Intergenic
931891309 2:66675571-66675593 CCAGGTCTTACTTGAATAGAGGG - Intergenic
933520918 2:83372500-83372522 GAAGGCATTAATTGATTATTGGG + Intergenic
945687674 2:212991922-212991944 CAAGGAATTCCTTCAGTAGAAGG - Intergenic
947153473 2:227137200-227137222 CAAGGCATTGCATGTGTAGATGG - Intronic
947199029 2:227598457-227598479 CTAGGGTTTACTTGAGTAGAAGG - Intergenic
1170884542 20:20328948-20328970 CAAGGGGTTTCTTGATAAGAAGG - Intronic
1174522840 20:51145035-51145057 TAAGGCATTCATTGATTTGAAGG + Intergenic
1178472856 21:32909426-32909448 CAAGGCATCACTGGAAAAGAAGG + Intergenic
1178621806 21:34183711-34183733 CAAAAGATTACTTGATTAGCTGG + Intergenic
1178624454 21:34203397-34203419 AAAGACCTTACTCGATTAGATGG - Intergenic
951045561 3:18034152-18034174 TATGACATTACCTGATTAGATGG + Intronic
951049930 3:18082976-18082998 CAAGGCATTATTTCATTATCAGG + Intronic
952688628 3:36177580-36177602 CAAGGCCTTCCTTGGTTTGAAGG + Intergenic
955078134 3:55633011-55633033 TAAGGCTTCTCTTGATTAGATGG - Intronic
955538403 3:59949048-59949070 CTATGGATTACTTGAGTAGAGGG - Intronic
956035174 3:65082944-65082966 AATGGCATTATTTAATTAGAAGG + Intergenic
956050182 3:65239715-65239737 CATGGCAGTACTTGGTTATAAGG + Intergenic
962830423 3:139134364-139134386 CAAGGACTTCCTTTATTAGATGG - Intronic
964165263 3:153697143-153697165 CAAAGCTTTACTTTATTTGAGGG + Intergenic
966048233 3:175579581-175579603 CAAGGCACTATTTTATGAGAAGG - Intronic
972246903 4:37254785-37254807 CAAGGAAGTATTTCATTAGAAGG - Intronic
972748549 4:41965664-41965686 CAAGGCCATACTTGATGAGTTGG + Intergenic
979088294 4:116443450-116443472 AAAGGCTTTACTTGATTTTATGG + Intergenic
980019959 4:127697244-127697266 CACGGAATTTCTTTATTAGATGG - Intronic
983722418 4:170872225-170872247 CATGGCATTTCTTGGTTGGATGG + Intergenic
984680599 4:182604814-182604836 CAAAGCATTACTGAACTAGAAGG - Intronic
986421594 5:7589874-7589896 CCAGGCTTTACTTCATTGGATGG - Intronic
990938725 5:61178297-61178319 CAAGGCATTACCTGCTTACGTGG - Intergenic
992035834 5:72775126-72775148 CAAGGCATCACATGATGAGGGGG - Intergenic
993245964 5:85453436-85453458 CAAGGCATAACTTGACTGGTGGG + Intergenic
997121910 5:131183336-131183358 CAAGTCATGAGTTGATTATATGG - Intronic
1005967659 6:30739230-30739252 GAATGCACTGCTTGATTAGAGGG + Intronic
1006605395 6:35252703-35252725 CAAGGAAATATATGATTAGAAGG + Exonic
1008077730 6:47163294-47163316 CAAGGCCTTCCTGGCTTAGAGGG - Intergenic
1010017454 6:71121737-71121759 CAAGGTCTTTCATGATTAGAGGG + Intergenic
1010609914 6:77941896-77941918 CAAGGCATTACTAGCCTAAACGG + Intergenic
1012761460 6:103308428-103308450 CAAGGCACTACTTGACTTCAGGG - Intergenic
1013562952 6:111324772-111324794 AAAAGCATTACTTCATTAAAGGG + Intronic
1014888027 6:126805922-126805944 CAAGGAATTTCTTTATTTGATGG - Intergenic
1014995800 6:128142764-128142786 TAAGGCATTGCATGAATAGAAGG - Intronic
1015728317 6:136322594-136322616 CAAGGTATTAATTTATGAGAGGG + Intergenic
1015912052 6:138178912-138178934 CAGGGCTTTAGTTGAGTAGAGGG - Intronic
1017339010 6:153298529-153298551 GAAGGCATTACGTGTTGAGAGGG - Intergenic
1018209283 6:161464712-161464734 CAAGGCATTATTTAATTATTTGG - Intronic
1019201919 6:170323944-170323966 CAAGGCCTTACTGAAATAGAAGG - Intronic
1020452915 7:8340214-8340236 CAAGGCTTTTCTTGAAAAGAGGG + Intergenic
1020819145 7:12943977-12943999 CAAGGCTTTATTTCATTCGAAGG - Intergenic
1026126076 7:67580712-67580734 CAAGGCATCACAAGATTAGGGGG + Intergenic
1027111833 7:75446145-75446167 AAAGGCATTTCTGGATGAGATGG + Intronic
1027284063 7:76630676-76630698 AAAGGCATTTCTGGATGAGATGG + Intergenic
1028050797 7:86183252-86183274 CCAGGCATCTCTTGTTTAGATGG - Intergenic
1030681464 7:112438826-112438848 CATGGCAACACTTGTTTAGAAGG + Intronic
1031952694 7:127908620-127908642 CTAGGTCTTACTTGATTTGAAGG + Intronic
1033664397 7:143426994-143427016 GAAGGCATTTCTTGAAGAGATGG + Intergenic
1039891170 8:41686435-41686457 TAAGGAATTTCTTGATAAGAAGG - Intronic
1041850165 8:62381952-62381974 GAGGGCATTACTTTAGTAGAAGG - Intronic
1043156287 8:76784890-76784912 CTATGCATTACTTGATCAGTTGG + Intronic
1046008198 8:108511900-108511922 CAAGGCTCCACTTGATTAAAGGG - Intergenic
1051987884 9:23112102-23112124 GGAGGCTGTACTTGATTAGAAGG - Intergenic
1052141778 9:24994331-24994353 CAATGAATCTCTTGATTAGAAGG - Intergenic
1052607565 9:30723932-30723954 CAAGGCATATCTGGATTAGGGGG - Intergenic
1059692784 9:116701667-116701689 AAAGGCATGACTGGTTTAGATGG - Intronic
1060719453 9:125965628-125965650 CAAGACTTTACTTGATGGGATGG + Intronic
1186097431 X:6117218-6117240 CAAGGCATTAACTGAAAAGATGG - Intronic
1186375464 X:8994324-8994346 AGAGGCATTACTGGATTAAATGG - Intergenic
1186410460 X:9341549-9341571 AAAGTCATTTCTAGATTAGAGGG + Intergenic
1186457206 X:9719020-9719042 CAGGCCATTTCTTGATTACAGGG - Exonic
1192203856 X:69083330-69083352 CAAGCCTTTGCTTGCTTAGAGGG + Intergenic
1192246509 X:69377496-69377518 CAAGACATTAGTTGGTTTGAGGG + Intergenic
1197666811 X:129233117-129233139 CAAGGCATGACTTGACTGCAAGG - Intergenic
1197695860 X:129549146-129549168 CAAGGCATCTCTTTATTAGAGGG + Intronic
1197755872 X:129994284-129994306 CAAGGCATTACTTGATTAGATGG + Intronic
1200614045 Y:5357521-5357543 CAAGGAAGTACATGTTTAGAAGG + Intronic