ID: 1197756365

View in Genome Browser
Species Human (GRCh38)
Location X:129998105-129998127
Sequence GTGAGCTATCCCTACTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197756365_1197756370 -1 Left 1197756365 X:129998105-129998127 CCCCCAAAGTAGGGATAGCTCAC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1197756370 X:129998127-129998149 CAGTGGTTCCTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 127
4: 4193
1197756365_1197756376 22 Left 1197756365 X:129998105-129998127 CCCCCAAAGTAGGGATAGCTCAC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1197756376 X:129998150-129998172 CAGTGACCAGGGTTGATTCTTGG 0: 1
1: 0
2: 1
3: 17
4: 126
1197756365_1197756377 23 Left 1197756365 X:129998105-129998127 CCCCCAAAGTAGGGATAGCTCAC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1197756377 X:129998151-129998173 AGTGACCAGGGTTGATTCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1197756365_1197756373 11 Left 1197756365 X:129998105-129998127 CCCCCAAAGTAGGGATAGCTCAC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1197756373 X:129998139-129998161 TGCCTTCCAGGCAGTGACCAGGG 0: 1
1: 0
2: 1
3: 25
4: 270
1197756365_1197756372 10 Left 1197756365 X:129998105-129998127 CCCCCAAAGTAGGGATAGCTCAC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1197756372 X:129998138-129998160 CTGCCTTCCAGGCAGTGACCAGG 0: 1
1: 0
2: 2
3: 35
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197756365 Original CRISPR GTGAGCTATCCCTACTTTGG GGG (reversed) Intronic
901817623 1:11803776-11803798 GTGAGCTGTTCCTTCTCTGGAGG - Intronic
905340998 1:37277462-37277484 CTGAGGTAGCCCTACTGTGGAGG - Intergenic
920728822 1:208463389-208463411 GGGAGCCAGCCCTACTTTGGTGG - Intergenic
923831023 1:237557374-237557396 CTTAGCTGTACCTACTTTGGTGG - Intronic
1076275863 10:129197809-129197831 GTGAGTCATCCCCACTGTGGGGG + Intergenic
1097011438 12:55956080-55956102 GTGAGTCTTGCCTACTTTGGTGG - Intronic
1102731753 12:115117457-115117479 TTGAGTTTTCCTTACTTTGGGGG + Intergenic
1106455790 13:29925426-29925448 GAGAACTCTACCTACTTTGGTGG - Intergenic
1111014399 13:82359012-82359034 GTTAGCCATCCCTGCTTTTGGGG + Intergenic
1117570050 14:57038860-57038882 TTGAGATATACCTACATTGGTGG + Intergenic
1119320163 14:73725866-73725888 GAGAGCTACCCCAGCTTTGGTGG + Intronic
1125395703 15:39245309-39245331 GGAAGGTATCCCTACTGTGGGGG - Intergenic
1145170413 17:20651659-20651681 GAGAGTGATCCCGACTTTGGAGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1152385921 17:79974739-79974761 GTTAGCTAGCCCTACTGTGTGGG - Intronic
1154229784 18:12544994-12545016 GTGAGCTAACAGTATTTTGGTGG - Intronic
1162839064 19:13342194-13342216 ATGAGCTTTCCCTGGTTTGGGGG + Intronic
926007963 2:9387452-9387474 GTTTGCTAACCCTAATTTGGAGG + Intronic
926460565 2:13124797-13124819 GGGAGCCATTCCTACCTTGGTGG + Intergenic
932264629 2:70356978-70357000 GTTAGCTATTCTTACTTTGGTGG - Intergenic
932591223 2:73069074-73069096 GTGGGCCATGCATACTTTGGGGG + Intronic
936062349 2:109303362-109303384 GTGGGCACTCCCCACTTTGGGGG + Intronic
939034752 2:137117486-137117508 GTTAGATATTCATACTTTGGAGG + Intronic
948949578 2:241240257-241240279 GTGTGCTAGCCCCATTTTGGGGG - Intronic
1182031146 22:27160347-27160369 GTGAGCTTTGCATGCTTTGGGGG + Intergenic
1183174667 22:36214040-36214062 GCTACCTATTCCTACTTTGGGGG - Intergenic
1184552344 22:45211008-45211030 CTGAGCTAGCCCCACTTTGGAGG - Intronic
955032733 3:55236865-55236887 GTGGGCAAGCCCTACTGTGGAGG - Intergenic
955466952 3:59247299-59247321 GTGAGGTATGGCAACTTTGGGGG + Intergenic
956836248 3:73098404-73098426 ATGAGCTGTCCCTACTCTGCTGG + Intergenic
957364981 3:79211484-79211506 GTCACCTTTCCCTACATTGGGGG - Intronic
960659325 3:120041065-120041087 GTGGGCTCTGCCTACTGTGGAGG - Intronic
960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG + Intronic
963693647 3:148536877-148536899 TTGAGCTATCCTAACCTTGGAGG - Intergenic
966028601 3:175317328-175317350 ATGTGCTAACCCTGCTTTGGTGG - Intronic
970421551 4:15909978-15910000 GGGAGCCATCTCTACTTTGATGG + Intergenic
978621609 4:110638695-110638717 CTGGGCTTTCCCTACTTTTGGGG + Intronic
980117041 4:128689317-128689339 GGGAGATCTGCCTACTTTGGAGG + Intergenic
983988504 4:174089975-174089997 TTGTGCTATCCCTTCTTTGTGGG + Intergenic
989557043 5:42809356-42809378 GAGAGCTAGCCCTAGTTTTGAGG - Intronic
989615810 5:43335757-43335779 GTGAGACATCCCTACTGGGGGGG - Intergenic
994521041 5:100835750-100835772 TGGACCTATCCCCACTTTGGGGG + Intronic
995770746 5:115666167-115666189 GTGAGCTAAGCCTGCTTTAGGGG - Intergenic
1000543350 5:162568205-162568227 GCAAGCTTTCCCTAATTTGGTGG + Intergenic
1000767952 5:165315492-165315514 GTCAGCTCTCCCTGCTTTGCTGG + Intergenic
1003161108 6:3635571-3635593 GTGAGCTGTGCTTTCTTTGGAGG + Intergenic
1005711665 6:28508946-28508968 GTGAGCCATTTGTACTTTGGAGG + Intronic
1008908284 6:56705107-56705129 TAGAGCTATCCCTACTTGGCAGG - Intronic
1009635498 6:66259733-66259755 GTGAGATATCCCTGGTTTGAGGG + Intergenic
1015947324 6:138516163-138516185 GTGTGCCATCCCTACTTTCATGG + Intronic
1021903220 7:25308590-25308612 GTTACCTATCTCTACTTTGCAGG - Intergenic
1021903448 7:25310451-25310473 GTTATCTATCTCTACTTTGTAGG + Intergenic
1028812594 7:95104696-95104718 GTGAACTAACCTTAATTTGGGGG + Intronic
1033487013 7:141800858-141800880 GTAAGCTATCCCTGCTTTCCTGG - Intergenic
1042278434 8:67029093-67029115 GTGTGCTATGCCTACCTTGAAGG - Intronic
1043850848 8:85215138-85215160 GTGAATTATCCCTAATTTGTTGG - Intronic
1057411883 9:94823757-94823779 GTGAGATTTCCCTACTTCTGAGG - Intronic
1058340256 9:103886898-103886920 GTGGGCCATCCTTATTTTGGAGG - Intergenic
1185843517 X:3415968-3415990 GTGAGCTCAGCCTACTTTAGTGG + Intergenic
1188878340 X:35460586-35460608 GAGAGCTATCCTTCCCTTGGCGG - Intergenic
1189341035 X:40204758-40204780 ATGATCTATCCATATTTTGGGGG + Intergenic
1197756365 X:129998105-129998127 GTGAGCTATCCCTACTTTGGGGG - Intronic
1200763691 Y:7062807-7062829 GTGAGACATCCCCACTGTGGGGG - Intronic