ID: 1197756983

View in Genome Browser
Species Human (GRCh38)
Location X:130002479-130002501
Sequence AGACAGAGGGAGACCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1269
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 1171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197756975_1197756983 5 Left 1197756975 X:130002451-130002473 CCAGCAAAAGGCAGACTAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG 0: 1
1: 0
2: 4
3: 93
4: 1171
1197756973_1197756983 15 Left 1197756973 X:130002441-130002463 CCAGAGAGAGCCAGCAAAAGGCA 0: 1
1: 0
2: 3
3: 27
4: 314
Right 1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG 0: 1
1: 0
2: 4
3: 93
4: 1171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197756983 Original CRISPR AGACAGAGGGAGACCGGGGA GGG Intronic
900017433 1:162327-162349 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900047692 1:520923-520945 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900210740 1:1454686-1454708 ACACCGAGGCAGACAGGGGAAGG - Intronic
900216617 1:1485356-1485378 ACACCGAGGCAGACAGGGGAAGG - Intronic
900223698 1:1523084-1523106 ACACCGAGGCAGACAGGGGAAGG - Intronic
900236766 1:1596807-1596829 AGACAGAGAGATACATGGGAAGG + Intergenic
900421715 1:2558641-2558663 AGACAGAGGTGGACGGGGGCCGG - Intronic
900467747 1:2834049-2834071 AGTCAGAGGGAGACATGGGGTGG - Intergenic
900467980 1:2835070-2835092 AGCCAGAGGGAGTCGGGGGTCGG + Intergenic
900470333 1:2850844-2850866 AGAAAGAGAGAGGCAGGGGAGGG + Intergenic
900520742 1:3104426-3104448 AGGCAGAGGCTGCCCGGGGAGGG + Intronic
900669671 1:3843246-3843268 ACAGAGAGGGTGACCGAGGATGG + Intronic
900805316 1:4763744-4763766 AGACAGAGGGAGAGGGAGAAAGG - Intronic
900811149 1:4802181-4802203 GGAGAGATGGAGACAGGGGAGGG - Intergenic
900846534 1:5107357-5107379 AGGCGGAGGGAGTCCAGGGAGGG + Intergenic
901128297 1:6944628-6944650 TGACACAGGGAGACCGGGGCAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901315393 1:8304040-8304062 GGACAGAGGGAGGCAGGTGATGG + Intergenic
901499568 1:9643425-9643447 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
901767859 1:11515332-11515354 AGACACAGGGAGACGGTGGGGGG - Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
901798164 1:11692214-11692236 AGACAAAGGGAGACTGGGTCAGG - Intronic
902018440 1:13327503-13327525 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018446 1:13327522-13327544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018452 1:13327541-13327563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018458 1:13327560-13327582 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018464 1:13327579-13327601 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018470 1:13327598-13327620 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018476 1:13327617-13327639 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018482 1:13327636-13327658 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018488 1:13327655-13327677 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902040089 1:13486204-13486226 AGACAGAGGGAGAGGCTGGAGGG - Intronic
902654734 1:17859526-17859548 AGAGAGAGAGAGATGGGGGAGGG + Intergenic
902672900 1:17987344-17987366 AGACAGAGAGAGATTGGAGATGG - Intergenic
902705206 1:18199678-18199700 GGAGGGAGGGAGACCAGGGAAGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903163152 1:21503477-21503499 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
903638148 1:24834799-24834821 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638154 1:24834818-24834840 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638160 1:24834837-24834859 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638166 1:24834856-24834878 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638176 1:24834888-24834910 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638188 1:24834926-24834948 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638194 1:24834945-24834967 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638204 1:24834977-24834999 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903650160 1:24917155-24917177 AGAAAGAGGGAGGCACGGGACGG - Intronic
903921802 1:26804853-26804875 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921808 1:26804872-26804894 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921814 1:26804891-26804913 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903949819 1:26989935-26989957 AGAGAGAGAGAGACGGGGGTGGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903995667 1:27304064-27304086 AGACAGAGGGAGAAGGAGGTGGG - Intronic
904045826 1:27607559-27607581 AGACAGAGGGGGAGCAGGGTCGG + Intergenic
904501324 1:30914462-30914484 AAACAGAGGGAGCCTGGGCAGGG + Intergenic
904556151 1:31365950-31365972 AGACAGAGTGAGATGGGGGGTGG + Intronic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
904939814 1:34157710-34157732 AGATAGAGTGAGACAGGTGATGG - Intronic
905089531 1:35417717-35417739 AGAGAGATGGCGACCGGGCACGG + Intronic
905538074 1:38739370-38739392 AGACAGAGGGAGCCCGTAGGAGG + Intergenic
905587161 1:39129578-39129600 AGTCAGAGTAAGACCAGGGATGG + Intronic
905813800 1:40932277-40932299 AGACTGAGGGAGCCCAGGGGAGG - Intergenic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906288128 1:44601684-44601706 AGAGAGAGGGGGACAGGAGATGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906527196 1:46501147-46501169 AGACAGAGAGAGAGAGGGAAGGG - Intergenic
906719634 1:47996236-47996258 AGAGAGAGGGAAGCCTGGGAGGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907165697 1:52408876-52408898 AGACAGAGGCAGGCTGGGTAAGG - Intronic
907181286 1:52572641-52572663 AGAGAGAGGGAGAAGGGAGAGGG - Intergenic
907416143 1:54315288-54315310 AAACAGAGGTAGACCAGGCATGG - Intronic
907459982 1:54599655-54599677 AGACAGCGGGAGACAGGGGCTGG - Intronic
907463477 1:54620082-54620104 ACACAGTGGGAGCCCAGGGAGGG - Intronic
907525124 1:55049586-55049608 AGATAGAGGGAGGCCTAGGAAGG + Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909076802 1:71058799-71058821 AGGGAGAGGGATACTGGGGAAGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
910801364 1:91150003-91150025 AGACAGAGAGAGACAGATGAAGG + Intergenic
911114784 1:94236493-94236515 AGACAGATGGAGAGAAGGGAAGG + Intronic
911121287 1:94299748-94299770 AGCCAGAGGGAGGAAGGGGAGGG + Intergenic
911335642 1:96576901-96576923 AGACAGAGTGGGACGGGGGAAGG + Intergenic
911769671 1:101724384-101724406 AGACAGAGAGAAGCGGGGGAAGG + Intergenic
912131769 1:106611793-106611815 AGAGGGAGAGAGACAGGGGATGG + Intergenic
912547422 1:110460942-110460964 ATCCAGAGGGAGGCCGGGGTGGG + Intergenic
912595590 1:110872667-110872689 AGACAGAGGGAGTATGAGGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912772030 1:112472981-112473003 AGAGAGAGGGAGGGAGGGGAGGG + Intronic
912917098 1:113826359-113826381 AGAAAGAGAGAGACAGAGGAAGG + Intronic
913074898 1:115333752-115333774 AGAAAGAGAGAGAGGGGGGAGGG - Intronic
913270749 1:117090782-117090804 AGACAGAGGTAAGCTGGGGAGGG - Intronic
913996983 1:143659492-143659514 AGACAGAGGGAGAGAGGAGTAGG + Intergenic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
914505270 1:148283276-148283298 AGACAGAGGGAGAGAGGAGTAGG - Intergenic
914507295 1:148300871-148300893 AGACAGAGGGAGAGAGGAGTAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915103267 1:153515818-153515840 AGAATGAGGGAGGCTGGGGAGGG - Intergenic
915356388 1:155257455-155257477 AGAGTGATGGAGACCTGGGATGG - Intronic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
916573422 1:166046758-166046780 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
916702185 1:167308544-167308566 GGACAGAGTGAGACCAGGGAAGG - Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
917848617 1:179041679-179041701 AGGGAGAGGGAGACGGGAGACGG + Intronic
918076736 1:181176314-181176336 AGACAGAGGAAGAGAGAGGAAGG + Intergenic
918127250 1:181595541-181595563 GGAGAGTGGGAGACCCGGGAAGG - Intronic
918283582 1:183029615-183029637 AGAGAGAGAGAAACTGGGGAAGG - Intronic
918447553 1:184630288-184630310 TGAGAGAGAGAGACAGGGGAAGG - Intergenic
918454604 1:184695980-184696002 AGAGACAGGGAGGCAGGGGAAGG - Intronic
919056943 1:192583024-192583046 AGAGAGAGGGAGAAAGGGAAAGG + Intergenic
919686458 1:200487859-200487881 AGAGAGAGAGAGACGGGGGGGGG + Intergenic
920215992 1:204361864-204361886 TCCCAGAGGGAGGCCGGGGAGGG + Intronic
920505645 1:206513541-206513563 AGACAGAGCGAGACCCTGCAGGG - Intronic
921232190 1:213084143-213084165 AGACAGAGGAAGAGAGGGAAAGG - Intronic
921320208 1:213931288-213931310 GGACACAGGGAGACTAGGGAGGG - Intergenic
921805298 1:219447036-219447058 AGACAGAGAGAGACAGGGGCGGG - Intergenic
922105275 1:222508245-222508267 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
922265608 1:223980823-223980845 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922476824 1:225912101-225912123 AGACAGCGGGGCACTGGGGAAGG + Intronic
922485273 1:225969133-225969155 AGACAGAGGGAGCAAGGGGCGGG + Intergenic
922549093 1:226480849-226480871 AGAGAGAGAGAGACAGGAGAGGG - Intergenic
922720858 1:227899618-227899640 AGACAGAGGGAGACAGAGAGTGG - Intergenic
923678514 1:236100466-236100488 AGACAGAGCGAGTCGGGGAAAGG - Intergenic
923742567 1:236669128-236669150 AGACAGAGAGAGAAAGGGAAAGG - Intergenic
923841037 1:237670326-237670348 AGGGAGAGGGAGACGGGAGAGGG + Intronic
924347449 1:243085778-243085800 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
924585496 1:245357749-245357771 AGACAGAGGGAGGCTGGTGCTGG + Intronic
924660036 1:246007517-246007539 AGGCAGAAGGAGGCCGGGCATGG + Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
924856147 1:247876948-247876970 AGAGAGAGACAGAGCGGGGAAGG - Exonic
1062902192 10:1154800-1154822 AGGCAGAGGGAGACTGGACAAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063153136 10:3354936-3354958 AGGCAGAGGGAGCCAGAGGAAGG - Intergenic
1063511248 10:6647060-6647082 AGAGAGAGGGAGAGAGGGAAAGG - Intergenic
1063692177 10:8297199-8297221 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1063876480 10:10484196-10484218 AGACAGAGAGAGGAGGGGGAGGG - Intergenic
1063953305 10:11244004-11244026 AGACAGCAGGAGACGGGGGAGGG - Intronic
1064050661 10:12056737-12056759 AGAGAGAGAGAGACTGGGCACGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064368293 10:14728002-14728024 AGACAGAGGGAGAGAGGGAGAGG - Intronic
1065218083 10:23470048-23470070 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1065840148 10:29695811-29695833 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840154 10:29695830-29695852 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840162 10:29695855-29695877 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840168 10:29695874-29695896 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840174 10:29695893-29695915 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840180 10:29695912-29695934 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840192 10:29695949-29695971 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065910902 10:30304650-30304672 AGAGAGAGAGAGACGGGGGTGGG + Intergenic
1066085112 10:31968968-31968990 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085118 10:31968987-31969009 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085124 10:31969006-31969028 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085130 10:31969025-31969047 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085136 10:31969044-31969066 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085142 10:31969063-31969085 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085148 10:31969082-31969104 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085154 10:31969101-31969123 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066561248 10:36672152-36672174 AGAGAGAGGGAGGCAGGGCATGG + Intergenic
1066728904 10:38419092-38419114 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
1067089182 10:43257935-43257957 AGACAGGGCGAGGCAGGGGAAGG + Intronic
1067875487 10:50003422-50003444 AGACAGAGGGAAAGTGGAGATGG - Intronic
1068846437 10:61680960-61680982 AGAGAGAGAGAGAACGAGGATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069558544 10:69413676-69413698 GGACAGATGGAGACCAGGCAGGG + Intronic
1069596684 10:69676563-69676585 GGACAGAGGGAGACCAGGCTGGG - Intergenic
1069651604 10:70053441-70053463 GGCCCGAGGGAGCCCGGGGAGGG + Intronic
1070360738 10:75686162-75686184 GGACAGAGGGCCACTGGGGATGG + Intronic
1070629833 10:78076648-78076670 AGAGAGAGGGAGAGGGGAGAGGG + Intergenic
1071088480 10:81891942-81891964 GGACAGAGCGAGACAGAGGAAGG - Intronic
1071545625 10:86526773-86526795 AGACAGAGGCAGGCCCGGCAAGG - Intergenic
1072459412 10:95605529-95605551 AGATGGAGGGAGAGTGGGGAGGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072811701 10:98467482-98467504 AGAGAGAGGGAGAGAGGGAAGGG + Intronic
1072999450 10:100276308-100276330 AGAGAGAGGGAGACGGGAGAGGG - Intronic
1072999470 10:100276379-100276401 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999476 10:100276398-100276420 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999482 10:100276417-100276439 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999488 10:100276436-100276458 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999494 10:100276455-100276477 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999500 10:100276474-100276496 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999508 10:100276499-100276521 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1073048835 10:100655184-100655206 AGACACAGCGAGGCGGGGGAGGG - Intergenic
1073049087 10:100656321-100656343 GGACAGAGGGAGACTGGCGCGGG + Intergenic
1073249960 10:102115135-102115157 AGACTGGGAGAGACAGGGGACGG + Intronic
1073462107 10:103671739-103671761 AGACAGAGGGACAGGGGTGAAGG + Intronic
1074051830 10:109887456-109887478 AAACAGAGGTAGATGGGGGATGG - Intronic
1074140228 10:110666002-110666024 AGAGAGAGAGAGAGAGGGGAAGG + Intronic
1074552257 10:114455492-114455514 ACACAGAGGAAAACAGGGGAAGG + Intronic
1074756633 10:116628450-116628472 AGAGAGAGGGAGGGAGGGGAGGG + Intronic
1074911636 10:117914981-117915003 AGAGGGAGAGAGACAGGGGAGGG + Intergenic
1075103027 10:119519283-119519305 AGACACAGGGAGACAGGAGCTGG - Intronic
1075103054 10:119519392-119519414 AGACACAGGGAGACAGGAGCTGG - Intronic
1075103091 10:119519548-119519570 AGACACAGGGAGACAGGAGCTGG - Intronic
1075103120 10:119519682-119519704 AGACACAGGGAGACAGGAGCTGG - Intronic
1075103134 10:119519736-119519758 AGACACAGGGAGACAGGAGCTGG - Intronic
1075345065 10:121675977-121675999 AGACAGAGAGAGAAAGGGAAGGG - Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1076049487 10:127321229-127321251 AGAGAGGGGGAGGACGGGGAGGG - Intronic
1076234698 10:128854397-128854419 AGGCAGAGGGAGGCCAGGCAAGG - Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076461821 10:130653130-130653152 AGACAGAGCGTGACGGGGAAGGG - Intergenic
1076687923 10:132206459-132206481 GGCCAGAGGGAGCCCCGGGAAGG - Intergenic
1076974029 11:157533-157555 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1077021994 11:421053-421075 AGACAGGAGGAGATCAGGGAGGG + Intronic
1077603008 11:3586841-3586863 AGACAAAGGGAGACAGTAGATGG + Intergenic
1077864377 11:6210769-6210791 GGAATGAGGGAGACTGGGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078180253 11:9004622-9004644 AGGCAGAGGGTGCCCGGGGGAGG - Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1080812887 11:35723074-35723096 AGAGAGAGAGAGACGAGGGAGGG - Intronic
1081094127 11:38910843-38910865 AGAGAGAGAGAGACAGGGAATGG - Intergenic
1081642217 11:44764042-44764064 AGAAAGAGAGAGAGAGGGGAAGG + Intronic
1081666208 11:44918523-44918545 AGCCAAAGGGAGACTGGGGCGGG + Intronic
1081831752 11:46120831-46120853 AGGCAGAGGGGGAAGGGGGAGGG + Intronic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1082266864 11:50128773-50128795 AGACAGAGAGAGGCAGGTGATGG + Intergenic
1082289225 11:50349795-50349817 AGACAGAGAGAGGCAGGTGATGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083298745 11:61729117-61729139 AGCCGGGGGGAGACCGGGCAGGG - Intronic
1083514589 11:63244831-63244853 AGGCAGATGGAGACCTGGGGTGG + Intronic
1083865267 11:65450342-65450364 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865273 11:65450361-65450383 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865279 11:65450380-65450402 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1084441791 11:69178863-69178885 AGAAAGAAGGAGGGCGGGGAGGG + Intergenic
1084536099 11:69758053-69758075 AGACAGAGGGAAACTGGGTGGGG + Intergenic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085053368 11:73390925-73390947 AGCCAAAGGGAGTGCGGGGAGGG + Intronic
1085116894 11:73937671-73937693 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116904 11:73937702-73937724 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116910 11:73937721-73937743 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085754201 11:79190776-79190798 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754209 11:79190801-79190823 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754221 11:79190839-79190861 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754227 11:79190858-79190880 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754233 11:79190877-79190899 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754239 11:79190896-79190918 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754245 11:79190915-79190937 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754251 11:79190934-79190956 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754260 11:79190960-79190982 AGGGAGAGGGAGACGGGAGACGG - Intronic
1085754265 11:79190979-79191001 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754271 11:79190998-79191020 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754277 11:79191017-79191039 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754283 11:79191036-79191058 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754289 11:79191055-79191077 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754295 11:79191074-79191096 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754303 11:79191099-79191121 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754311 11:79191124-79191146 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085998282 11:81948929-81948951 AGAGAGAGAGAGAAAGGGGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087501759 11:98964984-98965006 AGACAGAGAGAGACAGGGACAGG + Intergenic
1088684434 11:112273106-112273128 AGAGAGAGAGAGAGGGGGGAAGG - Intergenic
1088974162 11:114799969-114799991 AGAAAGAGGGAGAGGGAGGAGGG - Intergenic
1089035851 11:115390350-115390372 AGAGAGAGGGAGAAGGGGAAAGG + Intronic
1089145617 11:116327834-116327856 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089739637 11:120573561-120573583 AGAAAGAGGTACACAGGGGATGG + Intronic
1089944712 11:122457080-122457102 AGAGAGAGAGAGATCGGGGGAGG + Intergenic
1089965586 11:122652586-122652608 GGCCAGAGGGAGACCCAGGATGG - Intergenic
1090147379 11:124339984-124340006 AGACAAAGGGATACGGGAGAAGG + Intergenic
1090193346 11:124792933-124792955 AGCCAGAGGGAAACAGGGAAAGG - Intronic
1090264748 11:125346883-125346905 AGAGAGAGGGATAGAGGGGACGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090937508 11:131357196-131357218 AGACAGAGGGAGGCCGAGGCAGG - Intergenic
1091378391 12:41237-41259 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378397 12:41256-41278 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378403 12:41275-41297 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091528020 12:1325197-1325219 AGACAGAGGGAAACATGGGTGGG - Intronic
1091952188 12:4603461-4603483 AAACAGAGGGAGAGAAGGGAAGG - Intronic
1091971874 12:4794242-4794264 AGAAACAGGGAGACCAGGAATGG - Intronic
1092065602 12:5587749-5587771 AGACAAAGGGAAACCTGAGAGGG - Intronic
1092167840 12:6353982-6354004 AGAGAGAGGGAGGCCGAGGCGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092721644 12:11447022-11447044 AGACAGAGAGAGAGAGAGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094328799 12:29270072-29270094 AAACAAAGGGAGACCTGAGAGGG - Intronic
1094653907 12:32402416-32402438 AGAGAGAGAGAGAGAGGGGAGGG + Intronic
1095458917 12:42420690-42420712 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1095492596 12:42750042-42750064 AGAGGGAGAGAGACAGGGGAGGG + Intergenic
1095825227 12:46524181-46524203 AGACAGAGGCAGAGATGGGAAGG - Intergenic
1095927863 12:47596891-47596913 AGAGAGAGAGAGACTGGGGCTGG + Intergenic
1095962101 12:47842103-47842125 GGCCAGAGGGAGAGCTGGGAAGG + Intronic
1095997819 12:48104243-48104265 AGAGAGAGAGAGACGGGGGGGGG + Intronic
1096147134 12:49286384-49286406 AGACAGAGGGAGAGACTGGAGGG + Intergenic
1096230225 12:49892640-49892662 AGACTGAGAGAGACCCTGGAGGG - Intronic
1096382752 12:51172860-51172882 AGAGAGAGCGAGACCTGGGAGGG - Exonic
1096565643 12:52475819-52475841 AGACAGAGGGTGAGAGAGGAGGG + Intergenic
1096743290 12:53709996-53710018 AGGGAGAGGGAGAGGGGGGAAGG + Intronic
1096871034 12:54592246-54592268 AGACAGAGGGAGGCCAGGTGGGG + Intergenic
1097459934 12:59849047-59849069 AGAGAGAGAGAGAGTGGGGAAGG - Intergenic
1097981097 12:65738818-65738840 AGAAAGAGGGAGGCCGAGGCGGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098716120 12:73830077-73830099 AGACTGAGGGAGAGAAGGGAGGG - Intergenic
1099082332 12:78201016-78201038 AGAAAGAGAGAGAGTGGGGAGGG - Intronic
1100017981 12:90035183-90035205 AGAATGAGGGAGAGTGGGGAGGG + Intergenic
1100570932 12:95842373-95842395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570938 12:95842392-95842414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570944 12:95842411-95842433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570950 12:95842430-95842452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570956 12:95842449-95842471 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570962 12:95842468-95842490 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570968 12:95842487-95842509 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570974 12:95842506-95842528 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100795489 12:98177373-98177395 AGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1101344125 12:103869601-103869623 AGAGAGAGAGAGATTGGGGAAGG - Intergenic
1101674900 12:106908778-106908800 AGACAGAGAGAGAGGGGGGAAGG - Intergenic
1101851152 12:108403470-108403492 AGAGAAAGGGAGAGAGGGGAGGG - Intergenic
1101858399 12:108463030-108463052 AGACAGAGGAAGGGAGGGGAGGG + Intergenic
1102186548 12:110951904-110951926 AGACAGAGGGAGAGGGAGGGGGG + Intergenic
1102216759 12:111167116-111167138 AGACAGAGACAGACAGGGGCAGG - Intronic
1102595916 12:113992556-113992578 AGACAGAGGCAGGCAGGGGCAGG - Intergenic
1102691638 12:114765942-114765964 AGACAGAGAGAGGAGGGGGAAGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103402177 12:120650530-120650552 AGACGGAGGGAGGCTGGGGTTGG + Intronic
1103676944 12:122663385-122663407 TGACAGAGGGAGACAAAGGAAGG - Intergenic
1103906038 12:124327661-124327683 AGACACATGGGGGCCGGGGAGGG + Intronic
1104277688 12:127344685-127344707 AGACAGAGGGCGGCGGGGGGTGG - Intergenic
1104459339 12:128941880-128941902 AGAGAGAGAGAGACCAGGCACGG - Intronic
1104619962 12:130303477-130303499 AGACAGAGAGAGACAGAGGGGGG + Intergenic
1104847977 12:131856437-131856459 AGACAGAGAGAGACAGGGACAGG - Intergenic
1104873144 12:132014923-132014945 ACAGAGAGGGAGACCCAGGACGG - Intronic
1104908479 12:132228234-132228256 TGTCAGAGGGACGCCGGGGAGGG - Intronic
1105845716 13:24292044-24292066 AGACAGAGAGAGGCCGGGCGCGG - Intronic
1106549318 13:30757915-30757937 CTAAAGAGGGAGACCAGGGAGGG - Intronic
1106679970 13:31999469-31999491 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1107143413 13:37030244-37030266 AAACTGAGGGAGACTAGGGAAGG + Intronic
1107224880 13:38036602-38036624 AGACTGAGGGAGAGAGGTGAAGG - Intergenic
1107562508 13:41571287-41571309 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562519 13:41571319-41571341 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562525 13:41571338-41571360 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1107888523 13:44894260-44894282 AGAGAGAGGGAGAGCGAGGGAGG - Intergenic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108783530 13:53866952-53866974 AGAAAGAGGAAGATAGGGGAGGG + Intergenic
1110723687 13:78794967-78794989 AGGCAGAGAGAAAGCGGGGAGGG + Intergenic
1110782319 13:79480977-79480999 AGACAGAGGCTGACAAGGGATGG - Intergenic
1111201353 13:84941965-84941987 AGACATAGAGAGAGAGGGGACGG - Intergenic
1111242226 13:85490084-85490106 AGACAAAGAGAGACCGTAGATGG - Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111906998 13:94266532-94266554 AGACTGAGGGAGGGTGGGGAAGG - Intronic
1113346493 13:109483057-109483079 GGACAGAGGAGGAGCGGGGAAGG - Intergenic
1113655851 13:112067550-112067572 AGACGGAGTGAGACGGGGGCGGG - Intergenic
1114066589 14:19064430-19064452 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1114095677 14:19335593-19335615 AGATAGAGGGGGAATGGGGAAGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114529570 14:23387481-23387503 AGACAGCGGCAGAACAGGGATGG + Intronic
1114907232 14:27145229-27145251 AGAAAGTGGGAGAGCGGGGTGGG - Intergenic
1115351337 14:32398807-32398829 AGAGAGAGGGAGAGAGGGGGAGG - Intronic
1115353267 14:32420328-32420350 AGAAAGAGAGAGACAGGGTAGGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116592357 14:46794397-46794419 AGACAGAGGGAGACAGAGAGAGG + Intergenic
1116868363 14:50049508-50049530 AGGAAGAGGGAGGCTGGGGAAGG - Intergenic
1117308430 14:54498623-54498645 AGACAGAGGGAGGAAAGGGAAGG + Intergenic
1118341420 14:64896659-64896681 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341426 14:64896678-64896700 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341432 14:64896697-64896719 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341438 14:64896716-64896738 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341444 14:64896735-64896757 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341450 14:64896754-64896776 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341456 14:64896773-64896795 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341462 14:64896792-64896814 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118557772 14:67044752-67044774 AGAGAGAGGGAGACAGGAGGAGG - Intronic
1118998932 14:70863266-70863288 AGAAAGAGAGAGACAGGGGAAGG + Intergenic
1119139687 14:72255089-72255111 AGGCAGAGGGAGATGGGGGATGG + Intronic
1119201882 14:72759538-72759560 AGACAGAGAGAGACAGAGAAAGG + Intronic
1119443856 14:74647742-74647764 AGACAGAGGGAGAGGGAGGCAGG - Intergenic
1120157544 14:81110366-81110388 ACACAGAGAGACACCAGGGATGG + Intronic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120752636 14:88212148-88212170 AGAAAGAGAGAGGCCGGGCATGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121426775 14:93857891-93857913 AGACAGAGAGAGACCCAAGAAGG + Intergenic
1121558272 14:94855010-94855032 AGACACAGTGAGGCAGGGGAGGG - Intergenic
1121608200 14:95256776-95256798 AGACATGGGGAAACTGGGGATGG + Intronic
1121793697 14:96718503-96718525 AGACAGAGAGAGGGCGGGGGAGG + Intergenic
1121894968 14:97638297-97638319 AGAAAGAGAGAGAAGGGGGAAGG - Intergenic
1122266498 14:100549264-100549286 AGTCAGATGGAAACCTGGGAGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122755251 14:103973549-103973571 AGGCAGAGGGCTGCCGGGGAGGG + Intronic
1122917932 14:104867348-104867370 ACACAGAGGCAGGGCGGGGATGG - Intronic
1123103151 14:105819160-105819182 AGGCAGAGGGAGACGTGAGAAGG - Intergenic
1123913562 15:24996737-24996759 AGATAGAGGAAGACAGGAGAAGG + Intergenic
1124153291 15:27201479-27201501 AAACAGAGGGAAATAGGGGAGGG + Intronic
1124206478 15:27725129-27725151 AGACAGAGGAGCACCGCGGAAGG + Intergenic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1125753478 15:42046271-42046293 AGACAGGGGGAGCCCATGGAGGG - Intronic
1125887177 15:43237840-43237862 AGAGTGAGGGAGACAGGGAAGGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126628752 15:50712492-50712514 AGACAGAGGGAGACTTGATATGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127724660 15:61737302-61737324 AGAGAGAGGGAGGCTGGTGATGG - Intergenic
1127907572 15:63387637-63387659 AGACAGAGGCAGAGAGGGAAGGG + Intergenic
1128084338 15:64875564-64875586 AGACCAAGGGAGTCTGGGGAGGG + Intronic
1128316038 15:66660012-66660034 AGAAAGAGAGAGAGCGGGGTGGG - Intronic
1129109389 15:73328845-73328867 TGACAGAGAGAGGCCAGGGATGG + Intronic
1129429678 15:75490512-75490534 AGAGAGAGGGAGACCAGGCATGG + Intronic
1131240907 15:90742581-90742603 AGAGAGAGAGAGACATGGGATGG - Intronic
1131366482 15:91846231-91846253 AGAGAGAGAGAGACAAGGGAGGG - Intergenic
1131790382 15:95958161-95958183 AGACGAAGGGAGAACAGGGATGG + Intergenic
1132092528 15:98957752-98957774 AGAGAAAGGGAGAACAGGGAAGG - Exonic
1132348311 15:101121721-101121743 GGACAGAAGGAGACCGAGAAAGG + Intergenic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133431006 16:5736721-5736743 ACACAGATGGAGAGAGGGGAGGG - Intergenic
1133475435 16:6116837-6116859 AGACAGAGGGAGAGAGAGGCTGG + Intronic
1133582601 16:7160787-7160809 AGAAAGGGGGAGACGGAGGAGGG - Intronic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1134012753 16:10867407-10867429 AGACAGAGGGAGAGCGAGAAAGG + Intergenic
1134205564 16:12235011-12235033 AGACAGAGAGAGACAGGGAAAGG - Intronic
1134506490 16:14811795-14811817 ACACAGAGAGACACCAGGGATGG - Intronic
1134574064 16:15316970-15316992 ACACAGAGAGACACCAGGGATGG + Intergenic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134728356 16:16439331-16439353 ACACAGAGAGACACCAGGGATGG - Intergenic
1134908429 16:18002221-18002243 ACTCAGAGGGAAAGCGGGGAGGG + Intergenic
1135277631 16:21127210-21127232 AGGCAGAGGGAGACCAGGCATGG + Intronic
1135325922 16:21525844-21525866 GGACACAGGGAGACCGTGGTTGG + Intergenic
1135593033 16:23718621-23718643 AGAGAGAGAGAGAGCGGGGGAGG + Intergenic
1135611477 16:23871428-23871450 AGACAGAGGGGGACAGGGGCAGG - Intronic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1136271031 16:29148382-29148404 AGACGGACGGAGACCGTGGTAGG - Intergenic
1136469070 16:30466382-30466404 AGACAGAGAGAGACAGAGAAAGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137535233 16:49316630-49316652 AGACAGAGAGAGACAGGGCGAGG + Intergenic
1137680370 16:50337904-50337926 AGAAAGAGGGAGAGAGGGAAGGG + Intronic
1137792359 16:51185617-51185639 GGACAGAGGGAAACAGAGGAGGG + Intergenic
1137905267 16:52315188-52315210 AGACGGAAGGAGATTGGGGATGG - Intergenic
1138179117 16:54930592-54930614 AGAGAGGGAGAGACCGGGGAGGG + Intergenic
1138420770 16:56897758-56897780 GGACAGAGGGAGGCAGAGGAAGG - Intronic
1139351400 16:66338468-66338490 AGAAAGAGGGAGAGTGGGGGAGG + Intergenic
1139392102 16:66611615-66611637 AGACAGAGGCTGGCCAGGGAGGG + Intronic
1139421573 16:66852491-66852513 AGAAAGAGAGAGAGAGGGGAAGG + Intronic
1139495587 16:67314859-67314881 AGAGAGAGAGAGAGAGGGGAAGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139807850 16:69584574-69584596 AGACCGAGGGAGGCCGAGGCAGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140049593 16:71468348-71468370 AGCCAGAGGGAGGCTGGGCATGG - Intronic
1141019312 16:80480024-80480046 AGACAGAGGCAGAGATGGGAGGG + Intergenic
1141029111 16:80572329-80572351 AGACAGAGAGAGACAGGAGGAGG + Intergenic
1141141664 16:81500416-81500438 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1141259416 16:82439154-82439176 AGAGAGAAGGAGGCCGGGCATGG - Intergenic
1141409483 16:83822690-83822712 AGACAAAGGGAGCCCGGGAGGGG - Intergenic
1141695039 16:85615077-85615099 ACACCGAGGGAGGCCAGGGAAGG - Intronic
1141945889 16:87310120-87310142 AGGCAGTGGGTGACCAGGGATGG + Intronic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142038955 16:87880535-87880557 GGACACAGGGAGACCGTGGTTGG + Intergenic
1142074646 16:88110391-88110413 AGACGGACGGAGACCGTGGTAGG - Intronic
1142345658 16:89552459-89552481 AGACGGACGGAGACGGGGCAGGG - Intronic
1142446229 16:90140130-90140152 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1142461276 17:95333-95355 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1142593802 17:1019888-1019910 AGACAGAGGGAGCTCGTGAAGGG + Intronic
1142652005 17:1359902-1359924 AGAGAGAGGGAGACGGGGAGGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142867924 17:2802177-2802199 TGACAGAGGGAGACTAGGCAGGG - Intronic
1142978782 17:3659816-3659838 AGACAGACGGAGGGCGGTGAGGG - Intronic
1143030212 17:3963650-3963672 AGAAAGAGGAAGACCTGGGGTGG + Intronic
1143126650 17:4645709-4645731 AGAAAGAGGGAGAGTGGGGAGGG - Intergenic
1143632897 17:8148896-8148918 AGGCAGAGGTAGGCCGGGCACGG + Intronic
1144026114 17:11277224-11277246 AGAGAAAGAGAAACCGGGGATGG - Intronic
1144027186 17:11287681-11287703 AGAGAGAGAGAGAAAGGGGAAGG + Intronic
1144100888 17:11941331-11941353 GGACAGAGGGAGAGAGGGGAAGG - Intronic
1144210928 17:13014905-13014927 AGGCAGAGGGAACCCGCGGAAGG + Intronic
1144273265 17:13640559-13640581 AGAGACAGGGAGGCAGGGGAAGG - Intergenic
1145254733 17:21316384-21316406 AGCCACAGGAAGACGGGGGAGGG - Intergenic
1145321867 17:21771581-21771603 AGCCACAGGAAGACGGGGGAGGG + Intergenic
1145405661 17:22589039-22589061 AGACAGAGGGAAACAAGGAAAGG - Intergenic
1145733429 17:27211250-27211272 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1145733452 17:27211326-27211348 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733460 17:27211351-27211373 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733466 17:27211370-27211392 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733472 17:27211389-27211411 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733478 17:27211408-27211430 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1146178947 17:30685113-30685135 AGACAGAGGGAGTTGTGGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146648884 17:34594031-34594053 AGATAGAGGGGGACCAGGGAGGG - Intronic
1146656058 17:34635981-34636003 AGGCAGAGCGGGACCGGGGTGGG - Intronic
1147054736 17:37825538-37825560 AGAAAGAGGGAGACAGGAAATGG + Intergenic
1147428393 17:40357023-40357045 AGGCAGAGGGAGAAAGGGGCTGG - Intronic
1147495027 17:40907404-40907426 AGACAGAGAGGGAGGGGGGAAGG - Intergenic
1148014209 17:44509601-44509623 AGAAAGAGAGAGAGGGGGGAGGG + Intergenic
1148068132 17:44888578-44888600 AGACAGAGTGGGAACTGGGAAGG + Intronic
1148193509 17:45697061-45697083 AGAGAGAGGGAGGGAGGGGAGGG + Intergenic
1148208667 17:45795081-45795103 GGACAGAGTGAGTCAGGGGAAGG + Intronic
1148602077 17:48901778-48901800 AGAGAGAGGGAGACGGGGGCGGG - Intergenic
1148681878 17:49478856-49478878 AGAGACAGGGAGACAGGAGAAGG + Intergenic
1148765712 17:50037249-50037271 AGACAGAGGGAGACAGGAATAGG + Intergenic
1148805952 17:50264169-50264191 AGAGGGAGGGAGAGTGGGGAAGG + Intergenic
1149583988 17:57772779-57772801 AGACAGAGGGCCAGCTGGGATGG + Intergenic
1149635781 17:58168170-58168192 AGATGGAGGGTGACAGGGGAGGG - Intergenic
1149652314 17:58283548-58283570 AGAAAGAAGGAGCCCAGGGAAGG + Intergenic
1150689591 17:67353305-67353327 AGAGAGAGGGAGCGGGGGGAAGG - Intronic
1151348206 17:73516207-73516229 AGACAGCTGGAGCCTGGGGAGGG + Intronic
1151377683 17:73702326-73702348 AGAGAGAGAGAGACAGGGGAAGG + Intergenic
1151385871 17:73754962-73754984 AGGCAGAGGGAGATTTGGGAGGG + Intergenic
1151429830 17:74055001-74055023 AGAGAGAGGGAGAAAGGGAAAGG - Intergenic
1151859051 17:76745682-76745704 AGAGGGAGGGAGATGGGGGATGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152323467 17:79622356-79622378 AGGCAGGGAGAGCCCGGGGAGGG - Intergenic
1152464959 17:80461182-80461204 AGAAAGAGGGAGGCCAGGCACGG + Intergenic
1152486173 17:80595085-80595107 AGAGAGAGAGAGACGGGGAATGG + Intronic
1152518252 17:80838682-80838704 AGACACGGGGAGGCCAGGGATGG + Intronic
1152681831 17:81672475-81672497 AGGCTGAGGGAGAGAGGGGAGGG - Exonic
1153289740 18:3488969-3488991 AGAGAGAGAGAGGCCGGGCACGG - Intergenic
1153450425 18:5221222-5221244 AGAGAGAGAGAGATGGGGGAGGG - Intergenic
1153515054 18:5895036-5895058 AGACCGAGGGAGGTCGGGGCCGG + Exonic
1153568694 18:6446369-6446391 AGACAGAGAGAGAGAGGGGGAGG + Intergenic
1153817929 18:8807067-8807089 GGATCGAGGGAGACCTGGGAGGG - Intronic
1154112295 18:11580406-11580428 AGACAGAGGGAGACGTAGGCAGG - Intergenic
1154165625 18:12012244-12012266 GGCCAGAGGGAGCCCAGGGAGGG - Intronic
1154211138 18:12379429-12379451 AGAGAGAGAGAGGCCGGGCAAGG + Intergenic
1154390898 18:13935134-13935156 AGACAGAGTGATGCCTGGGATGG - Intergenic
1155220367 18:23679932-23679954 AGAGAGAGAGAGACCAGGGCTGG - Intergenic
1155364182 18:25033849-25033871 AGAGAGAGGGAGAGAGGGGGGGG + Intergenic
1155833955 18:30554420-30554442 AGAGAGAGAGAGGCAGGGGAGGG - Intergenic
1155991245 18:32281682-32281704 AGACAGATGGAGGCCGGGCACGG + Intronic
1155993348 18:32303975-32303997 AGAAAGAGGGAGGGAGGGGAGGG + Intronic
1156523553 18:37743359-37743381 AGACAGAGAGAGAGAGGTGAGGG - Intergenic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157177522 18:45465130-45465152 ATACAGAGTGAGACAGAGGAGGG + Intronic
1157392500 18:47314587-47314609 AGAGAGAGGGAGAGAGGGGGGGG - Intergenic
1157455725 18:47827460-47827482 AGACGGGGGGAGACGGGAGAGGG - Exonic
1157523335 18:48360562-48360584 GGACAGAAGGAGCCAGGGGAGGG + Intronic
1157905160 18:51563242-51563264 AGGGAGAGGGAGTCCGGAGAGGG + Intergenic
1158001068 18:52619826-52619848 AGAGAGAGGGTGACTGGGGCTGG - Intronic
1158103896 18:53862301-53862323 AGACAGAGGGAGACACAAGAAGG + Intergenic
1158118726 18:54025548-54025570 AGACAGATGGAGAGCAGGGTGGG + Intergenic
1158544822 18:58387034-58387056 ACACAGAGGGAGGCAGGTGATGG - Intronic
1158648965 18:59269709-59269731 AGAGAGAGAGAGAAAGGGGATGG - Intronic
1158933780 18:62346363-62346385 ACACAGAGGGAGACAGAGAAGGG + Intronic
1158937017 18:62373855-62373877 AGAGAGAGTGGGACCAGGGACGG - Intronic
1159371041 18:67528138-67528160 AGACAGAGGGAGAAACTGGAGGG + Intergenic
1159386118 18:67727126-67727148 TGACAGATGGAGACAAGGGAAGG - Intergenic
1159974823 18:74698557-74698579 TGAGAGAGGGTGACCTGGGAAGG - Intronic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160616352 18:80132698-80132720 AGAAAGAGGGAGAGGGGAGAGGG - Intronic
1160650977 19:227700-227722 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1160900254 19:1424356-1424378 AGACGGAGGGGGAGGGGGGAGGG - Intronic
1160950454 19:1664401-1664423 AGAGAGAGGGAGGGAGGGGAGGG - Intergenic
1160951524 19:1669846-1669868 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
1160951540 19:1669907-1669929 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
1160951567 19:1670013-1670035 AGAGAGAGAGAGAAGGGGGAGGG - Intergenic
1160951629 19:1670230-1670252 AGAGAGAGAGAGACGAGGGAGGG - Intergenic
1161731070 19:5960913-5960935 AGACAGAGGGAGGCTATGGAAGG + Intronic
1162417605 19:10547357-10547379 GGGCAGAGGGACACTGGGGAAGG + Intronic
1162424065 19:10583491-10583513 AGACCCAGGGAGATCTGGGAAGG + Intronic
1162483116 19:10941045-10941067 AGACAGAGAGAGACAGAGGGAGG + Intergenic
1162582442 19:11539406-11539428 AGACAGAGGGGGACGGTGAAAGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162776539 19:12983360-12983382 AGACAGGGAGAGACCAGAGATGG - Intergenic
1162979666 19:14230441-14230463 AGACAGAGGGAGTTGTGGGAGGG + Intergenic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163274726 19:16276357-16276379 AGAGAGAGAGAGACTGGGCATGG - Intergenic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1164066240 19:21720271-21720293 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066246 19:21720290-21720312 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066252 19:21720309-21720331 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066258 19:21720328-21720350 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066264 19:21720347-21720369 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066270 19:21720366-21720388 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1165295595 19:34923009-34923031 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1165314194 19:35044907-35044929 AGAAAGAAGGAAACGGGGGAAGG + Intronic
1165426799 19:35750351-35750373 AGACAGAGTGAGGGTGGGGAAGG - Intronic
1165708826 19:37995239-37995261 AGACAGCAAGAGACAGGGGATGG + Intronic
1165939582 19:39408390-39408412 AGGCAGAGGGTGACAGTGGAAGG - Exonic
1166004001 19:39894720-39894742 AGAGAGACAGAGACAGGGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166343635 19:42152428-42152450 AGAGAGAGGGAGAGAAGGGAGGG - Intronic
1166982390 19:46639049-46639071 GGACACAGAGAGACCGGGGTAGG + Intergenic
1167102933 19:47415129-47415151 AGACAGAGGGAATTGGGGGAGGG + Intronic
1167258855 19:48446375-48446397 AGACAGGGGGCGCCTGGGGATGG - Exonic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167606166 19:50482092-50482114 AGAAAGAGAGAGAGAGGGGAAGG - Intronic
1167609240 19:50498709-50498731 AGACAGAGGGAGAGAGGGAGAGG + Intergenic
1167799356 19:51730162-51730184 AGACAGAGGGAGAGGGAGGGAGG + Intergenic
1167829570 19:52008344-52008366 TGACCGGGGGTGACCGGGGATGG + Intergenic
1167854906 19:52229524-52229546 AGACATCGAGAGAGCGGGGAAGG - Exonic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168115807 19:54220951-54220973 AGACAGACAGAGACAGGGGATGG - Intronic
1168118787 19:54240699-54240721 AGACAGACAGAGACAGGGGATGG - Intronic
1168121612 19:54255151-54255173 AGACAGACAGAGACAGGGGATGG - Intronic
1168125116 19:54278676-54278698 ACAGAGAGAGAGACAGGGGATGG - Intronic
1168133734 19:54337266-54337288 AGACAGACAGAGACAGGGGATGG - Intronic
1168169361 19:54575662-54575684 AGACAGAGAGAGACAGGGGATGG + Intronic
1168172144 19:54596045-54596067 AGACAGACAGAGACAGGGGATGG + Intronic
1168176862 19:54632870-54632892 AGACAGACAGAGACAGGGGATGG + Intronic
1168185681 19:54698055-54698077 AGACAGACAGAGACAGGGGATGG + Intronic
1168187651 19:54709961-54709983 AGACAGACAGAGACAGGGGATGG + Intergenic
1168205839 19:54850529-54850551 AGAGGGAGGGAGAGTGGGGATGG + Intronic
1168514629 19:57001271-57001293 AGAGAGAGCGAGACAGGGGAGGG + Intergenic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925140289 2:1545539-1545561 AGACACAGAAAGACCTGGGAAGG - Intergenic
925179626 2:1808669-1808691 AGAGTGAGGGCGACAGGGGAGGG + Intronic
925360635 2:3278112-3278134 AGACTGAGTGAGCCTGGGGACGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925417921 2:3685474-3685496 AGACAGAGAGAGACAGAGAAAGG + Intronic
926062965 2:9815575-9815597 AGAGAGAGGGAGACTCGAGACGG - Intergenic
926067655 2:9857060-9857082 AGAGAGGGGGACACTGGGGAAGG + Intronic
926353820 2:12021681-12021703 AGACAAAGGGAGACTGGGCAGGG + Intergenic
926975736 2:18515104-18515126 AGACAGAAGCAGGCCTGGGAAGG - Intergenic
927099105 2:19774254-19774276 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929157986 2:38804869-38804891 AGACAGAGAGTGACAGGAGAGGG - Intronic
929441766 2:41970712-41970734 AGGCTCAGGGGGACCGGGGAAGG + Intergenic
929737674 2:44567636-44567658 AGACAGAGACAGACATGGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929747645 2:44675466-44675488 AGAAAGAAGGAGAACAGGGAGGG - Intronic
929973662 2:46609694-46609716 AGAGAGAGGGAGGGTGGGGAAGG + Intronic
930136185 2:47905907-47905929 AGACAGACGGAGACCGAGCGAGG + Intergenic
930209006 2:48615471-48615493 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209012 2:48615490-48615512 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209018 2:48615509-48615531 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209024 2:48615528-48615550 AGGGAGAGGGAGACGGGAGAGGG + Intronic
931157691 2:59653961-59653983 AGCCAGAGGGAGAAAAGGGAAGG - Intergenic
931751863 2:65338168-65338190 AGGGAGAGGGAGACGGGAGACGG - Intronic
931751868 2:65338187-65338209 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751874 2:65338206-65338228 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751884 2:65338238-65338260 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751890 2:65338257-65338279 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751896 2:65338276-65338298 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751902 2:65338295-65338317 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931767432 2:65469416-65469438 AGAGAGAGAGAGAGCGGGGAGGG - Intergenic
931832418 2:66066424-66066446 AGACAGTGGGAGCCCGGGATAGG + Intergenic
932015343 2:68020778-68020800 AGACAGAGAGAAACTGAGGAAGG - Intergenic
932026174 2:68135548-68135570 AGACAGAGGGAGAGAGAGAAAGG + Intronic
932132101 2:69197085-69197107 AAAAAGAGGGAGACGGGTGATGG - Intronic
932430520 2:71671410-71671432 AGACAGAGGGAGAGGGGGCCTGG + Intronic
933132660 2:78691827-78691849 AGACAGAGAGAGAGAGGAGAGGG - Intergenic
933155201 2:78965384-78965406 AGACAGAGAGATACCTTGGAAGG + Intergenic
934526588 2:95055910-95055932 AGACAGAGGCAGAGAGGTGAGGG - Intergenic
934945983 2:98542088-98542110 AGAAAGAGGGTGATCGGGGCAGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935676376 2:105598077-105598099 AGGCAGAGGGAGGCAGGGAAGGG - Intergenic
936012916 2:108936508-108936530 AGAGCGTGGGAGGCCGGGGAAGG - Intronic
936060070 2:109289156-109289178 AGAGAGAGAGAGACAGGGGATGG - Intronic
936233934 2:110726791-110726813 AGACAGAGACAGACAGAGGAAGG + Intergenic
937148906 2:119672395-119672417 AGGCAGAAGGAGCCAGGGGAAGG + Intergenic
938069216 2:128299736-128299758 AGACAGAGGCACACAGGGTAGGG + Intronic
938483980 2:131684558-131684580 AGATAGAGGGGGAATGGGGAAGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938565004 2:132510609-132510631 AGAAAGAGGGAGAACTGGGTTGG + Intronic
938695174 2:133828388-133828410 AAAGAGAGGGAGTCCAGGGAAGG + Intergenic
938772547 2:134512716-134512738 AGAAAGAGGGAGAATGGTGAAGG + Intronic
939079914 2:137647396-137647418 AGACAGAGAGAGATCGGAGTAGG - Intronic
939433037 2:142135203-142135225 AGACTGAGAGAGACAGGGGGCGG + Intergenic
939770561 2:146310797-146310819 AGACAGAGGGAGAAGAGAGAAGG - Intergenic
940012743 2:149072176-149072198 AAACATAGGGAGACTGAGGAGGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941226723 2:162858664-162858686 TCACAGAGGGAGACAGGTGAGGG + Intergenic
942179318 2:173364957-173364979 AGAAAGAGGAAGACCGTGGATGG + Exonic
942593124 2:177567375-177567397 AGGAAGAGGGGGCCCGGGGATGG - Intergenic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943773166 2:191741093-191741115 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773172 2:191741112-191741134 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773178 2:191741131-191741153 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773186 2:191741156-191741178 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773198 2:191741195-191741217 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773204 2:191741214-191741236 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
945090544 2:206172597-206172619 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090550 2:206172616-206172638 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090556 2:206172635-206172657 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090562 2:206172654-206172676 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090568 2:206172673-206172695 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090574 2:206172692-206172714 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090580 2:206172711-206172733 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090592 2:206172748-206172770 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090604 2:206172785-206172807 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090612 2:206172810-206172832 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090618 2:206172829-206172851 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090626 2:206172854-206172876 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090634 2:206172879-206172901 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090642 2:206172904-206172926 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090650 2:206172929-206172951 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090658 2:206172954-206172976 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090664 2:206172973-206172995 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090670 2:206172992-206173014 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090680 2:206173024-206173046 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090690 2:206173056-206173078 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090696 2:206173075-206173097 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090702 2:206173094-206173116 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090708 2:206173113-206173135 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090716 2:206173138-206173160 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
945499824 2:210557980-210558002 AGAGAGATGGAGACAGGGGGAGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945970611 2:216227534-216227556 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970617 2:216227553-216227575 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970623 2:216227572-216227594 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970629 2:216227591-216227613 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970635 2:216227610-216227632 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970645 2:216227642-216227664 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970651 2:216227661-216227683 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970657 2:216227680-216227702 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970663 2:216227699-216227721 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970669 2:216227718-216227740 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970675 2:216227737-216227759 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945988534 2:216373510-216373532 AGAGAGAGAGAGAGCGGGGTGGG - Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947941921 2:234064238-234064260 AGAGAGAGAGAGACAGAGGAAGG - Intronic
948354036 2:237362800-237362822 ACACAGAGGGAAACTAGGGAGGG + Intronic
948451035 2:238071821-238071843 AGACAGAGGGAGTGCGAGGAAGG - Intronic
948989212 2:241543515-241543537 AGAAAGAGGGAGAAGGGGAAGGG - Intergenic
949049972 2:241892396-241892418 GGAGAGAAGGAGACCAGGGAGGG - Intergenic
1168903445 20:1385517-1385539 AGAAGCAGGGAGACCAGGGAGGG - Intronic
1169020354 20:2326412-2326434 AGACAGAGGGAGGCCAGAGGAGG - Intronic
1169061511 20:2663825-2663847 AGAAGTAGGGAGACCCGGGAGGG + Intronic
1169085316 20:2822522-2822544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085322 20:2822541-2822563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085338 20:2822592-2822614 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085344 20:2822611-2822633 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085350 20:2822630-2822652 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085356 20:2822649-2822671 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085362 20:2822668-2822690 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085368 20:2822687-2822709 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085374 20:2822706-2822728 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085380 20:2822725-2822747 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085386 20:2822744-2822766 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085392 20:2822763-2822785 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085398 20:2822782-2822804 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085404 20:2822801-2822823 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085410 20:2822820-2822842 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085416 20:2822839-2822861 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085422 20:2822858-2822880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085428 20:2822877-2822899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085434 20:2822896-2822918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085440 20:2822915-2822937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085446 20:2822934-2822956 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085452 20:2822953-2822975 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085458 20:2822972-2822994 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085464 20:2822991-2823013 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169392904 20:5204655-5204677 AGACAGAAGGAGGCCGGGCATGG - Intergenic
1169424607 20:5486052-5486074 TGACAGCTGGAGACTGGGGAGGG - Intergenic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1169974258 20:11305780-11305802 AGACAGAGAGAGAAAGGAGAGGG - Intergenic
1170040371 20:12033896-12033918 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
1170533421 20:17316479-17316501 AGAGAAAGGGAGACAGGGAAGGG - Intronic
1170637204 20:18117597-18117619 AGACAGAGAGAGAGAGAGGAAGG + Intergenic
1170990189 20:21294130-21294152 AGACAGAGAGAGAGAGGTGAGGG + Intergenic
1171232636 20:23499975-23499997 AGAAAGAGAGAGAAAGGGGAAGG + Intergenic
1171461478 20:25300507-25300529 GGACAGGGGGAGTCCGGGCAGGG - Intronic
1171779801 20:29408658-29408680 AGAGAGAGAGAGAGCGGGCAAGG - Intergenic
1172292172 20:33784228-33784250 AGAGGGAGGGAGATGGGGGAGGG - Intronic
1172840724 20:37901636-37901658 AGACAGAGGGAAGACGGCGAGGG + Intergenic
1172902928 20:38347958-38347980 AGGCAGAGGGAAATCAGGGAAGG + Intronic
1173067814 20:39729756-39729778 AGAGAGAGAGAGACAGGGGAGGG - Intergenic
1173125675 20:40333709-40333731 AGACACAGGGATACAGGTGATGG - Intergenic
1173283449 20:41649468-41649490 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
1173806431 20:45928581-45928603 AGAGAGAGAGAGACTGGGCATGG + Intergenic
1173849402 20:46208352-46208374 AGCCAGAGGCAGAGCAGGGATGG - Intronic
1173888029 20:46478986-46479008 AGACTGAGGGTGGCCAGGGATGG - Intergenic
1173945095 20:46944138-46944160 GGACAGAGGGAGCCAGGTGAGGG + Intronic
1173987662 20:47275006-47275028 AGAGAGAGAGAGACCAAGGAAGG + Intronic
1174169185 20:48605600-48605622 GGACAGAGGGACAGAGGGGATGG + Intergenic
1174306031 20:49614937-49614959 AAACAAAGGGAGAACGGGGAGGG + Intergenic
1174423483 20:50415926-50415948 AGAGAGCGAGAGACAGGGGATGG + Intergenic
1175515160 20:59564922-59564944 AGACAGAGGGAGACAGACGGAGG + Intergenic
1175648503 20:60696297-60696319 AGACAGAAGGAGGCCAGAGAGGG - Intergenic
1175748070 20:61475495-61475517 AGAGAGAGGGAGAGGAGGGAGGG - Intronic
1176101170 20:63365187-63365209 AGAAAGGGGAAGCCCGGGGAAGG + Intronic
1177686374 21:24442452-24442474 AGACAGAGGGAGACAGTGTGAGG - Intergenic
1177706252 21:24709162-24709184 AGAGAGAGAGAGACAGGGGCAGG + Intergenic
1177833470 21:26166286-26166308 AGACAGAAGGTGGCAGGGGAAGG - Intronic
1178370553 21:32023569-32023591 AGTCAGAGGGAGCTGGGGGAGGG - Intronic
1178824634 21:36004971-36004993 AGACAGGGGGAGGCAGGGGAAGG + Intergenic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1179195007 21:39156532-39156554 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195015 21:39156557-39156579 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195023 21:39156582-39156604 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195029 21:39156601-39156623 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195037 21:39156626-39156648 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179558536 21:42196067-42196089 AGAAAGGGGGAGAGTGGGGAGGG + Intergenic
1180142916 21:45903161-45903183 AGGCATATGGAGACTGGGGAAGG + Intronic
1180300354 22:11032091-11032113 AGAGACAGAGAGACAGGGGAGGG - Intergenic
1180418639 22:12793457-12793479 AGACAGACGAAGACCAGGCATGG + Intergenic
1180485070 22:15787020-15787042 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1181049598 22:20232292-20232314 AGACAGTGGGGGGCCTGGGAAGG - Intergenic
1181322760 22:22021279-22021301 AGACAGAGGGGGAGCTGGTATGG + Intergenic
1181465157 22:23106937-23106959 ACACACAGGGAAACCAGGGAGGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181770270 22:25120140-25120162 AGGCAGTGGGAGATGGGGGAAGG - Intronic
1181956778 22:26592978-26593000 AGACAGATTGAGACCTGGAAAGG - Intronic
1182053669 22:27332443-27332465 GGAGAGAGAGAGACCGGGGATGG - Intergenic
1182171127 22:28230632-28230654 ATACAGAGAGAGACTGGGGGAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183432469 22:37774165-37774187 AGACAGAGGGGGACCAGGGTTGG - Exonic
1183653451 22:39171875-39171897 AAACACAGGCAGACGGGGGATGG - Intergenic
1183871894 22:40746373-40746395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871900 22:40746392-40746414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871906 22:40746411-40746433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871912 22:40746430-40746452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871920 22:40746455-40746477 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871926 22:40746474-40746496 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871932 22:40746493-40746515 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871938 22:40746512-40746534 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871944 22:40746531-40746553 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871950 22:40746550-40746572 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871956 22:40746569-40746591 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871966 22:40746601-40746623 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184246143 22:43236714-43236736 AGGCTGGGGGAGGCCGGGGAGGG - Intronic
1184275258 22:43406223-43406245 GGACAGAGGGATAGCGAGGAGGG - Intergenic
1184372027 22:44088760-44088782 AGTCTGAGGGAGGCCGGGCACGG - Intronic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1185169314 22:49283203-49283225 AGATAGAGCAAGACCTGGGATGG - Intergenic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949844986 3:8360673-8360695 AGACAAAGGGAGACCACAGAAGG + Intergenic
950339474 3:12229940-12229962 TGACGGAGAGAGACCAGGGAGGG - Intergenic
950409799 3:12828161-12828183 AGACAGAGTGAGTCTGGGGCTGG + Intronic
950892319 3:16414969-16414991 TGACAGAGGAAGTCCGTGGAGGG + Intronic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952882126 3:37991593-37991615 AGAGAAAGGGAAACCAGGGAAGG + Intronic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953797332 3:45995584-45995606 GGTCTGAGGGAGACCTGGGATGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955116696 3:56012340-56012362 AGCCAGAGGGATTCCTGGGAAGG - Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
956373558 3:68589864-68589886 AGAGACAGTGAGACAGGGGATGG + Intergenic
956411454 3:68984199-68984221 AGAGAGAGAGAGAGAGGGGAGGG - Intronic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956873735 3:73442266-73442288 AGACAGAGGGGAAGTGGGGAGGG + Intronic
956908732 3:73794942-73794964 AGACAGAGAGAGGCAGGCGAGGG + Intergenic
957218937 3:77357366-77357388 GGACAGAGGGAGAGAGGGAAAGG - Intronic
958580625 3:96016539-96016561 AGACAGAGAGTGACTGGAGATGG + Intergenic
958750840 3:98192147-98192169 AGACATAGGGAGAAGGGGTAGGG - Intronic
959187736 3:103068088-103068110 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959788271 3:110327904-110327926 AGACAGAGAGGGAAGGGGGAAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960812084 3:121635149-121635171 AGACAGAGTGACGTCGGGGAAGG - Intronic
961547134 3:127642496-127642518 AGGCACAGTGAGACCAGGGAAGG + Intronic
961756218 3:129128673-129128695 ACACAGCGGGAGGCCTGGGATGG - Intronic
962373559 3:134841040-134841062 AGAAGGAGGGAAACCAGGGAAGG - Intronic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
963047328 3:141112353-141112375 AGACAGAAGGAGGCCGGGCGCGG + Intronic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
963228713 3:142888781-142888803 AGAGAAAGGGAGCCCGGGCAGGG + Intronic
963700107 3:148614946-148614968 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964847075 3:161055766-161055788 AGAGAGAGAGAGATTGGGGAGGG - Intronic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965435379 3:168644362-168644384 AGACAGAGAGAGACAGGGAAGGG - Intergenic
965475210 3:169147767-169147789 AGAGAGAGAGAGATGGGGGATGG + Intronic
966324129 3:178735267-178735289 GGACAGAGGGACACAGGAGATGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967697510 3:192550003-192550025 AGACAGAGAGAGACAGAGGGAGG - Intronic
967775064 3:193377785-193377807 AGACAGAGACAGACAGGGGAAGG - Intronic
968145053 3:196291107-196291129 AGACAGAGAGAGAGAGAGGAAGG + Intronic
968366853 3:198192287-198192309 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
968478192 4:822354-822376 AGACAGAGGGAGACAGAGACAGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968628184 4:1637423-1637445 GGACAGAGGGAGCCTGGGGGAGG + Intronic
968725899 4:2247679-2247701 TGACAGAGGGAGGCAGGGCACGG + Exonic
968824873 4:2887805-2887827 AGACACAGGGAGAGCAGGGCTGG + Intronic
969134358 4:5018608-5018630 AGAGAGGGGAAGACCCGGGAGGG - Intronic
969278183 4:6151051-6151073 AGACAGTGGGAGACTGGGGAAGG - Intronic
970015485 4:11507848-11507870 AGAAAGAGAGAGAGTGGGGAGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970775437 4:19668992-19669014 AGTCTGAGGTAGACCTGGGAAGG + Intergenic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971403409 4:26297385-26297407 AGACAGAGAGAGACGGTGTATGG + Intronic
971864211 4:32147734-32147756 AGAGAGAGAGAGACAGAGGAGGG + Intergenic
971928309 4:33044086-33044108 AGACAGAGAGAGAGAGGAGAGGG + Intergenic
972090019 4:35269929-35269951 AGACGGAGGGAGGGAGGGGAAGG - Intergenic
972135379 4:35886368-35886390 TGACTGAGGGAGAGGGGGGAAGG - Intergenic
972574422 4:40338817-40338839 AGAGAGAGCGAGCACGGGGAGGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
972691574 4:41403850-41403872 AGACAGAGGGAGAAAACGGAAGG - Intronic
972755226 4:42039764-42039786 AGATAGAGGGAAAAAGGGGAAGG - Intronic
973263199 4:48185847-48185869 AGGGAGAGGGAGACGGGAGAGGG - Intronic
973363148 4:49183820-49183842 AGACAGACGAAGACCAGGCATGG - Intergenic
973397945 4:49613040-49613062 AGACAGACGAAGACCAGGCATGG + Intergenic
973746304 4:53966619-53966641 AGACAGAGAGAGATCAGAGATGG + Intronic
973762601 4:54133352-54133374 AGAAAGAGAGAGAGAGGGGAGGG + Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974579792 4:63781350-63781372 AGAGAGAGGGGGGCCGGGGGTGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976633009 4:87258898-87258920 AGACAGAGGGTGAGGGCGGAGGG - Intergenic
977065149 4:92304817-92304839 AGACACACAGAGACCGGAGAGGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978660755 4:111123620-111123642 AGACAGAGGGAGAGAGAGGGAGG + Intergenic
978795125 4:112701185-112701207 AGCCAGAGGGAGAGAGAGGAGGG + Intergenic
978902585 4:113970574-113970596 AGCCAGTGGGGGACCTGGGAGGG + Intronic
979101055 4:116615254-116615276 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
979255267 4:118601896-118601918 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979333069 4:119438616-119438638 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
979397820 4:120209443-120209465 AGACAGAGAGAGATCGTGGTGGG - Intergenic
979448828 4:120844612-120844634 AGAGAGAGAGAGATGGGGGAAGG - Intronic
980104124 4:128570820-128570842 AGACAGTGGGAGCCCGCTGAAGG - Intergenic
980133381 4:128837149-128837171 AGAAACAGGGAGACCAGAGAGGG - Intronic
981001502 4:139833246-139833268 AGACAGAGAAAGACAGGGGGAGG + Intronic
981099024 4:140810778-140810800 AGAGAGAGGGAGAGAGGGAAAGG - Intergenic
981818374 4:148857338-148857360 AGTCTGAGGGAGTCCGTGGAGGG - Intergenic
981938190 4:150256070-150256092 AGACAGCGGCAGGCCTGGGATGG + Exonic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982437081 4:155392169-155392191 AGACAGAGAGAGAAAGAGGAAGG + Intergenic
982560708 4:156925752-156925774 AAAAAGAGAGAGACGGGGGATGG + Intronic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983808602 4:172027513-172027535 AGAGAGAGAGAGACAGGGAATGG - Intronic
984033105 4:174629797-174629819 AGCCAGAGGGACACCTGTGAGGG - Intergenic
984790125 4:183607529-183607551 AGACACCGGCAGACCAGGGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
984850964 4:184152210-184152232 AGACACACGGAGACCGCGGAGGG - Intronic
984953456 4:185023313-185023335 AGACAGAGGGAGACAGGAGCGGG - Intergenic
985203615 4:187508746-187508768 AGACAGAGGAAGAAAGGTGATGG - Intergenic
985314448 4:188640594-188640616 AGACAGAGGGATAAAGTGGAAGG - Intergenic
985716898 5:1467861-1467883 AGAGAGAGGGCGGCGGGGGATGG - Intronic
985774780 5:1835182-1835204 AGACAAAGGGCGACCAGTGAGGG + Intergenic
985915621 5:2916759-2916781 AGACACAGGGAGACAGAGAAAGG - Intergenic
986287088 5:6367326-6367348 ACACAGAGGGAGACTTGGGTAGG + Intergenic
986309862 5:6543944-6543966 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
986762919 5:10896543-10896565 GGACACAGGCAGACAGGGGAAGG + Intergenic
986931865 5:12834982-12835004 AGAGAGAGAGAGAGAGGGGAGGG - Intergenic
987448910 5:18056835-18056857 AGAGAGAGGGAGACAGAGAAGGG + Intergenic
987546314 5:19314734-19314756 AGAAAGAGGGAGAGAGAGGAAGG + Intergenic
987917806 5:24238633-24238655 AGAAAGTGGGAGAAAGGGGAAGG - Intergenic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
989105702 5:37861400-37861422 AGAGAGAGAAAGAGCGGGGAAGG - Intergenic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990536966 5:56732666-56732688 AGGAAGAGGGAGGCTGGGGAAGG + Intergenic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
990879635 5:60524671-60524693 AGGCAGAGGGAGAGAGGGCAGGG - Intergenic
991073996 5:62514590-62514612 AGGGAGAGGGAGACGGGAGAGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991702632 5:69330624-69330646 ACTCAGAGGGAGACCTGGAATGG - Intronic
991761877 5:69924960-69924982 AGACAGAGAAAGACTGGGTAGGG - Intergenic
991785452 5:70193140-70193162 AGACAGAGAAAGACTGGGTAGGG + Intergenic
991841105 5:70800009-70800031 AGACAGAGAAAGACTGGGTAGGG - Intergenic
991943964 5:71882081-71882103 AGACACAGAGAGACCAGGCACGG - Intergenic
992184655 5:74232386-74232408 AGAGAGAGGGAGGACAGGGATGG - Intergenic
992586971 5:78250961-78250983 AGACAGAGGCAAACAGAGGATGG + Intronic
993332159 5:86614630-86614652 AGGGAGAGGGAGACAGGGAAAGG - Intergenic
993427398 5:87784898-87784920 AGACAGAGGGAAAAGGAGGAAGG + Intergenic
994292285 5:98042137-98042159 AGACAGAGGGAAAGAGGGGGAGG + Intergenic
994650441 5:102520265-102520287 AGACAGAGGGAGGCTGGGTGTGG + Intergenic
994952356 5:106480705-106480727 AGAGAGAGAGAGACGAGGGAGGG - Intergenic
995712137 5:115046676-115046698 AGACAGAGAGAGGCAGGGGAAGG + Intergenic
995815003 5:116158156-116158178 AGACGGAGGGAGAGGAGGGAGGG - Intronic
995834355 5:116385508-116385530 AGAAAGAGGGAGAACTGGGTTGG + Intronic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996431154 5:123379082-123379104 AGACAGAGATAAACCGGGTAAGG + Intronic
996529455 5:124512381-124512403 AGACAGAAGGAGAGAGGGGTTGG - Intergenic
996916699 5:128720815-128720837 AGACAAAGGGAGCCTGGAGAAGG - Intronic
997256160 5:132429734-132429756 TGACAGAGGGAAACAGAGGAAGG - Intronic
997298932 5:132788211-132788233 AGAGAGAGAGAGACAGGGGTTGG + Intronic
997321806 5:132983928-132983950 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
997815480 5:137013068-137013090 ACAGAGAGAGAGACAGGGGAAGG + Intronic
998251547 5:140557101-140557123 AGACAGACGGAGAATGGGGGGGG - Intronic
998295545 5:140966440-140966462 AGACAGAGGGGGAGGGGGAAAGG - Exonic
999454003 5:151699627-151699649 AGACAGAGTCAGACAGTGGAAGG + Intergenic
999937325 5:156501373-156501395 TGACAAAGGGAGTCAGGGGAAGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000531048 5:162420280-162420302 GGAGAGAGGGAGATGGGGGAAGG + Intergenic
1001383824 5:171321641-171321663 AGGGAGAGGGAGGCCGGGGGAGG - Intergenic
1001400909 5:171445985-171446007 AGAGAGAGAGAGACAGGAGAAGG - Intronic
1001635010 5:173203420-173203442 AGAAAGAGGGAGGAGGGGGAGGG - Intergenic
1002571496 5:180142173-180142195 AGACAGAGGGAGAAATGGAAAGG - Intronic
1002635245 5:180604224-180604246 AGACAGAGTGAGAACTGGGTTGG - Intronic
1002644831 5:180648002-180648024 AGGAAGAGAGAGACCCGGGAGGG - Intronic
1002762171 6:210496-210518 AGACAGTGGGAGACTGAGGGAGG - Intergenic
1002765570 6:235866-235888 AGAGAGAGGGAGAGGAGGGAAGG + Intergenic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003869079 6:10387639-10387661 AGCCAGGGGGAGAGCTGGGAGGG - Intergenic
1004617378 6:17303496-17303518 AGACAGAGGAAGGGGGGGGAGGG + Intergenic
1005015399 6:21370722-21370744 AGGCAGTGGGAGACTGGGGGAGG - Intergenic
1005451582 6:25978158-25978180 AGACAGAGGGAGACCTGAGGTGG - Intronic
1005601133 6:27427233-27427255 AGACAGATGGAGAACGGGGTAGG + Intergenic
1005836965 6:29717712-29717734 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836971 6:29717731-29717753 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836977 6:29717750-29717772 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836983 6:29717769-29717791 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836989 6:29717788-29717810 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836995 6:29717807-29717829 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837001 6:29717826-29717848 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837012 6:29717858-29717880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837018 6:29717877-29717899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837024 6:29717896-29717918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837030 6:29717915-29717937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1006180729 6:32151974-32151996 GGGCGGAGGGAGAGCGGGGAGGG + Intronic
1006258786 6:32852016-32852038 TGAGAGAGAGAGAGCGGGGAGGG + Intronic
1006507918 6:34502357-34502379 AAACAGAGGGAAACAGGGGAAGG + Intronic
1006671478 6:35732082-35732104 AGACCGGGGGAGGCCCGGGACGG + Intergenic
1006840627 6:37026054-37026076 AGGAAGAGGGAGAGGGGGGAGGG - Intronic
1007079007 6:39085565-39085587 AAACACAGGGAGACAGGAGATGG - Intronic
1007198774 6:40087392-40087414 AGAAAGAGAGAGAACTGGGAAGG + Intergenic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1007522841 6:42465689-42465711 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1007704092 6:43780690-43780712 AGACAGAGAGAGAGCGGGGGCGG - Intronic
1007745330 6:44039897-44039919 AGACAGAGGCAGTGAGGGGAAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008926787 6:56895995-56896017 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926793 6:56896014-56896036 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926799 6:56896033-56896055 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926805 6:56896052-56896074 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926811 6:56896071-56896093 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926817 6:56896090-56896112 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926823 6:56896109-56896131 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1009417061 6:63427332-63427354 AAAAAGAGGGAGGCCGGGCATGG - Intergenic
1010716611 6:79237528-79237550 AGAGAGAGGGAGAAGGGAGAAGG + Intergenic
1011009678 6:82689703-82689725 AGAAAGAGAGAGAGAGGGGAAGG + Intergenic
1011163426 6:84418876-84418898 AGATAGAGGGAGATTTGGGATGG - Intergenic
1012120258 6:95356823-95356845 AGAGAGAGAGAGGACGGGGAGGG + Intergenic
1012390287 6:98730266-98730288 ACCCAGAGGGAGACAGGGAAAGG - Intergenic
1012888188 6:104868723-104868745 AGAGAGAGAGAGACAGGAGAGGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013608571 6:111773486-111773508 AGGGAGAGGGAGAGCGGGGGAGG + Intronic
1014014199 6:116511007-116511029 AGAAAGAGGGAGAGTGGGAAGGG + Intronic
1014038840 6:116800185-116800207 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1014117503 6:117682191-117682213 AGACAGAGTAAGACTGGGGATGG - Intronic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014241096 6:119018237-119018259 AGACAGAGAGATATCAGGGAAGG + Intronic
1014761306 6:125359741-125359763 AGAGAGAGGGAGAAGAGGGAGGG + Intergenic
1014764410 6:125390105-125390127 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764416 6:125390124-125390146 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764422 6:125390143-125390165 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764428 6:125390162-125390184 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764434 6:125390181-125390203 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1015526051 6:134175895-134175917 AGAAAGAGGGAAAAGGGGGAGGG + Intronic
1015552436 6:134426129-134426151 AGAAAGAGGGAGAGGGAGGAAGG - Intergenic
1015843586 6:137496540-137496562 AGAGAGAGGCGGACGGGGGAGGG + Intergenic
1016167794 6:140969195-140969217 AGACAGAGAGAGAAAGGGGGAGG + Intergenic
1016779710 6:147944117-147944139 AGACAGAGTGAGAGAGGGGGAGG - Intergenic
1016882749 6:148927177-148927199 AGAGAGAGAGAGAAAGGGGAGGG + Intronic
1016953019 6:149599572-149599594 AGAGAGAGGGAGAGGGGAGAGGG - Intronic
1017129141 6:151093257-151093279 AGACACAGGGAGAACGTGGTGGG - Intronic
1017331276 6:153200436-153200458 AGACAGAGGCACATGGGGGAAGG - Intergenic
1018301592 6:162408927-162408949 AGGCAGAGGGAAAGCTGGGAGGG - Intronic
1018308499 6:162483572-162483594 GGAGAGAGGGAGACGGGGAAAGG + Intronic
1018609960 6:165638385-165638407 AGACAGAGAGAGAGGGTGGAAGG + Intronic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019315066 7:380524-380546 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019315095 7:380584-380606 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315110 7:380614-380636 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315125 7:380644-380666 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315138 7:380674-380696 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019414141 7:919772-919794 AGAGGGAGGGAGATGGGGGAGGG + Intronic
1019446077 7:1072020-1072042 ACACAGGGGAAGAGCGGGGAGGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019557770 7:1641177-1641199 AGATAGGGGAAGACTGGGGAAGG - Intergenic
1019704240 7:2489978-2490000 AGACCGAGGGAGACAGGAAAGGG - Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019895718 7:3981320-3981342 AGACGGAGGGAGACAGGGAATGG - Intronic
1020095985 7:5369606-5369628 AGAGAGAGAGAGACTAGGGAAGG + Intronic
1020438013 7:8186547-8186569 ATACAAATGGAGACAGGGGATGG + Intronic
1020712905 7:11631085-11631107 AGACACAGGGAATCTGGGGAAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1023059498 7:36314486-36314508 AGGCTGAGGGAGACCTGGGATGG + Intergenic
1023089132 7:36601358-36601380 AGAGGGAGGGAGAGGGGGGAAGG + Intronic
1023292952 7:38686668-38686690 AGATAGGGGGACACCGGGAAAGG + Exonic
1023397366 7:39763749-39763771 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1023760480 7:43461198-43461220 AGTCAGAGGGTGGCCGGGGCTGG + Intronic
1023840550 7:44095067-44095089 AGAGAGAGGGAGAGAGGGAAGGG + Intergenic
1024135843 7:46407072-46407094 AAACAGAGGGAGCCTGGGCAGGG + Intergenic
1024404417 7:48962358-48962380 AGACAGATGGAGTCGGGGGAGGG - Intergenic
1024522200 7:50315233-50315255 AGACAAAGGGAGACGGAGGGAGG + Intronic
1024919892 7:54545345-54545367 AGAAAGGGGGAGACCGGGAGAGG + Intronic
1025135307 7:56406719-56406741 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1025626898 7:63230817-63230839 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025626910 7:63230863-63230885 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026099776 7:67375128-67375150 AGACAGAGGGAGAGAGTAGAGGG + Intergenic
1026299814 7:69087804-69087826 AGAGAGAGAGAGGCCGGGCACGG + Intergenic
1026436775 7:70406169-70406191 AGGCAGAGGGAGGCCTGGCAAGG - Intronic
1026634531 7:72069783-72069805 AGATAGAGGGAGATTGGGTAGGG - Intronic
1028482098 7:91318064-91318086 AGAGGGAGGGAGAACAGGGAAGG + Intergenic
1028535471 7:91886873-91886895 AGAGAGAGGGAGACAGGGAGGGG - Intergenic
1028595849 7:92545844-92545866 AGGGAGAGGGAGACGGGAGACGG + Intergenic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029152609 7:98491649-98491671 AGACAGATGGAGCAGGGGGATGG - Intergenic
1030826993 7:114170295-114170317 AGAAGGAGAGAGACAGGGGAAGG - Intronic
1031021903 7:116638147-116638169 AGAGAGAGGGAGACGGAGGGAGG - Intergenic
1031051511 7:116950359-116950381 AGAAAGAGGGAGAGGGGGAAGGG - Intergenic
1031826170 7:126568497-126568519 AGACAGAGGGAGAGAGAGGGAGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033348378 7:140542500-140542522 AGAGAGAGGAAGATGGGGGAGGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034100894 7:148449512-148449534 AGAGAGAGAGAGACCAGGGTTGG - Intergenic
1034500511 7:151447771-151447793 AGAGAGAGAGAGACCGGGTGAGG + Intergenic
1034610089 7:152358968-152358990 AGACAGAGGGAGACTTCAGAAGG - Intronic
1034892678 7:154854848-154854870 AGACAGAGGGAGGGCTGGAAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035287300 7:157814537-157814559 GGACAGAGGGAGGACAGGGACGG + Intronic
1035308899 7:157952470-157952492 GGACACAGGGAGACAGGCGAGGG + Intronic
1035470560 7:159106477-159106499 GGGCAGAGAGAGGCCGGGGAGGG + Intronic
1035710578 8:1710223-1710245 AAAAAGAGGGAGGCCGGGTATGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036457106 8:8919348-8919370 AGACAGAGAGAGACGGGGAGAGG - Intergenic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1036745891 8:11409345-11409367 AAACAGAGGGAGCCCTGTGAAGG - Intronic
1037506786 8:19538637-19538659 GAACTGAGGGAGACCGGGGGAGG + Intronic
1037640168 8:20735095-20735117 AGATAGAGTGAGAGAGGGGATGG - Intergenic
1037739227 8:21592051-21592073 AAACAGGGGAAGACAGGGGAAGG + Intergenic
1038136552 8:24792259-24792281 AGAGAGAGAGAGAGAGGGGAAGG - Intergenic
1038488923 8:27955598-27955620 AAACAGAGACAGACCAGGGAGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038720475 8:30030920-30030942 AGAGAGAGGGAGGGAGGGGAGGG + Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039390840 8:37179817-37179839 AGCCAGAGGGGGAAAGGGGAGGG - Intergenic
1039426618 8:37491845-37491867 TGACAGAGTGAGACCTTGGAGGG - Intergenic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1039791276 8:40877712-40877734 AGACAGAGAGAGACGGAGTAGGG + Intronic
1040053035 8:43034001-43034023 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040684327 8:49853093-49853115 AGACAGAGAGAGAGAGGGGTGGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041357863 8:57021193-57021215 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357869 8:57021212-57021234 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1042665114 8:71195790-71195812 AGACAGAGGGAGAGAAGAGAAGG + Intergenic
1042743532 8:72077271-72077293 AGACAGGGGGTGACAGGGGTGGG + Intronic
1043009279 8:74861709-74861731 AGACAGAGGAAGAACAGGGAGGG + Intergenic
1043313017 8:78886101-78886123 AGAGAGAGGGAGTTGGGGGATGG - Intergenic
1043318240 8:78948071-78948093 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1044016444 8:87052844-87052866 AAATAAAGGGAGACCTGGGAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045550637 8:103169025-103169047 AGACACAGGGAGATGGGGGCAGG - Intronic
1046538392 8:115547300-115547322 AGAGAGAGGGAGAAAGGGAAGGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046941823 8:119938874-119938896 AGAAAGAGAGAGAGAGGGGAAGG - Intronic
1047248719 8:123166063-123166085 ATACAGAGGGAGTCGGGGGCTGG + Intergenic
1047732189 8:127736829-127736851 AGGCAGAGGGAAAACGGGAATGG + Intronic
1047751347 8:127883114-127883136 AGACAGAGAGAGAGAGAGGAAGG + Intergenic
1047969294 8:130070986-130071008 AGAGAGAGAGAGAGAGGGGAGGG + Intronic
1048031788 8:130640018-130640040 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
1048180977 8:132193884-132193906 AGCCAGAGGGAGAGCAGGGAAGG + Intronic
1048507165 8:135032114-135032136 AGACAGAGACAGACTGGAGAAGG - Intergenic
1048691290 8:136967405-136967427 AGACTGAAGGAGCCCTGGGAAGG + Intergenic
1048933846 8:139339114-139339136 AGTCAGAGGGATGCCGGGTAGGG + Intergenic
1049390553 8:142367501-142367523 AGACAGATGGACGCCGGGGCGGG + Intronic
1049720345 8:144112693-144112715 AGACAGAGGGTGAAGGGTGAGGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050746844 9:8885785-8885807 AGACAGAGGCAGGCCGGGCACGG - Intronic
1050794768 9:9524289-9524311 AGAAAGAGAGAGACTGGAGAGGG - Intronic
1051093330 9:13436239-13436261 AGACAGAGAGAGACAGAGAAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051343035 9:16128873-16128895 AGACACAGAGACACTGGGGAGGG - Intergenic
1051679556 9:19593445-19593467 GGGCTGAGGGAGACAGGGGAGGG + Intronic
1052002344 9:23300383-23300405 AGAGAGAGGGAGACTGTGAAAGG - Intergenic
1052142418 9:25003860-25003882 AGGCAGAGGGTGGCGGGGGAGGG + Intergenic
1052872586 9:33523444-33523466 AGGCAGAGGAAGACCAGGGCAGG + Intergenic
1053148697 9:35729442-35729464 AGGCAGAGGAAGACTGGAGAGGG + Intronic
1054851055 9:69847092-69847114 AGAAAGAGGGAGTGCGGGGCAGG + Intronic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1055150007 9:72985446-72985468 AGACAGTGGGAGCCAGGGGAGGG + Intronic
1055580745 9:77703883-77703905 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1056499407 9:87193070-87193092 AGAAAGAGGGAGAATGGGCAGGG + Intergenic
1057367987 9:94442054-94442076 ATACAGAGGAAGACGGGAGAAGG - Intronic
1057433737 9:95020282-95020304 ACACTGAGGGAGACAGGGAAAGG + Intronic
1058027565 9:100158916-100158938 AGGGAGAGAGAGAACGGGGAAGG - Intronic
1058432812 9:104933791-104933813 AGAGAGAGAGAGGCCAGGGACGG + Intergenic
1059380844 9:113922440-113922462 AGACAGGGGCAGGCCGGAGAGGG + Intronic
1060060217 9:120453250-120453272 AGACAGAGGGAGTGAGGGGAAGG + Intronic
1060176430 9:121500205-121500227 AGACAGCGGCAGGCCGGGGCTGG + Intergenic
1060996160 9:127875818-127875840 AGACGGAGAGAGCCTGGGGAGGG - Intronic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061220312 9:129246709-129246731 GGACAGAGGGAGGCGCGGGAGGG + Intergenic
1061393910 9:130332970-130332992 AGACAGCGGGGGTCTGGGGAGGG + Intronic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1061810822 9:133162087-133162109 AGACAGGGGGAGTCCTGGGTGGG + Intronic
1061810849 9:133162171-133162193 AGACAGGGGGAGTCCTGGGTGGG + Intronic
1061810859 9:133162199-133162221 AGACAGGGGGAGTCCTGGGTGGG + Intronic
1061810869 9:133162227-133162249 AGACAGGGGGAGTCCTGGGTGGG + Intronic
1061810879 9:133162255-133162277 AGACAGGGGGAGTCCTGGGTGGG + Intronic
1061810889 9:133162283-133162305 AGACAGGGGGAGTCCTGGGTGGG + Intronic
1061992504 9:134167231-134167253 AGACAGAGCGGGATCTGGGAGGG - Intergenic
1062050526 9:134444455-134444477 GGAAAGAGGGAGGCAGGGGAAGG - Intergenic
1062158178 9:135065658-135065680 AGACAGAGAGAGGCAGGGTAAGG - Intergenic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1062437221 9:136551597-136551619 AAAAAGAGGGAGACCGAGAAAGG - Intergenic
1062480949 9:136751068-136751090 AGAGAGAGGGAGGCAGGAGAGGG + Intergenic
1062483610 9:136763573-136763595 AGACAGAGGAGGGGCGGGGAGGG + Intronic
1062589854 9:137268928-137268950 AGACAGACGGAGACAGAGAAGGG + Intronic
1062670312 9:137704956-137704978 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1062751210 9:138255131-138255153 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1185483597 X:466177-466199 AGACAGAGGGACACAGAGGCCGG + Intergenic
1185485844 X:481518-481540 AGACAGAGGGAGGAAGGAGAGGG + Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1185645212 X:1610841-1610863 AGACAGAGGGAGAGGAGGGGAGG - Intergenic
1185918747 X:4065492-4065514 GGACAGAGGGAGAAGGGTGAGGG + Intergenic
1185924365 X:4129949-4129971 AGACAAAGGGAGAAAGCGGAAGG + Intergenic
1185999789 X:4995914-4995936 AGAGAGAGAGAGAAAGGGGAAGG - Intergenic
1186361965 X:8851788-8851810 AACCAGAGGGAGGCCGGGCATGG + Intergenic
1187122584 X:16423595-16423617 AGAAAGAGAAAGACAGGGGAAGG + Intergenic
1187204564 X:17169907-17169929 GGACAGAGGGAGAGCTTGGAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189748383 X:44193710-44193732 AGACAGAGGGAGAGTGGTCAAGG + Intronic
1189760229 X:44314588-44314610 AGACAGAGAGAGAGAGTGGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190212848 X:48461332-48461354 AGACAGAGGGACAGCATGGATGG - Intronic
1190276415 X:48902395-48902417 AGAGAGAGCGAGACAGGGAACGG + Exonic
1190334821 X:49255916-49255938 AGACTGAGGTAGAGAGGGGAGGG - Intronic
1190334973 X:49256862-49256884 GGACAGAGGGTGTCAGGGGAGGG + Intronic
1190561929 X:51694925-51694947 AGAGAGAGAGAGAGAGGGGAAGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190658687 X:52635207-52635229 GGACAGAGAGAGTGCGGGGAGGG + Intergenic
1190711290 X:53072579-53072601 AGACAGACGGAGACACAGGAGGG - Intronic
1190764346 X:53463734-53463756 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1192079670 X:68034631-68034653 AGAAAGAGAGAGACAGGAGAAGG + Intergenic
1192106769 X:68325610-68325632 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1192344526 X:70290115-70290137 AGGCCCAGGGAGAACGGGGAAGG + Exonic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192434675 X:71135952-71135974 AGCCAGAGAGGGAGCGGGGAGGG - Intronic
1192528093 X:71864961-71864983 ACACAGAGAAAGACAGGGGATGG + Intergenic
1192845652 X:74904693-74904715 AGAGAGAGGGAGAGAGGGAAAGG - Intronic
1193041401 X:77007422-77007444 AGACAAAGGAAGACATGGGATGG + Intergenic
1193940536 X:87676616-87676638 AGAAAGAGAGAGAAAGGGGAAGG + Intergenic
1195652297 X:107297766-107297788 AGAGAGAGAGAGATGGGGGAGGG - Intergenic
1195802360 X:108727024-108727046 AGCCAGAGAGAGACCAGGAAAGG + Intronic
1196417841 X:115491748-115491770 AGAGAGGGAGAGACGGGGGAAGG - Intergenic
1196536214 X:116847814-116847836 AGACAGAGAGAGAGAGAGGAGGG - Intergenic
1197207336 X:123801484-123801506 AGAAAGAGAGAGAGAGGGGAAGG + Intergenic
1197230557 X:123999435-123999457 AGACAGGGAGAGAAGGGGGAGGG - Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1197770841 X:130088278-130088300 AGATGGAGGGAGACCAGGTAGGG + Intronic
1198858365 X:141043233-141043255 AGAGAGAGGGAGACGGAGAATGG - Intergenic
1198904330 X:141544137-141544159 AGAGAGAGGGAGACGGAGAATGG + Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199800522 X:151246874-151246896 GGACAGAGGGAGCCCAGGGTAGG + Intergenic
1199993758 X:153005887-153005909 AGAGAGAGAGAGAGCAGGGAAGG + Intergenic
1200326809 X:155249086-155249108 AGAGAGAGAGAGAGCGGGGTGGG - Intergenic
1201253898 Y:12088395-12088417 AGAGAGAGGGAGACAAGGAAAGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic