ID: 1197758284

View in Genome Browser
Species Human (GRCh38)
Location X:130011195-130011217
Sequence CACCCACAGCTCCCAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197758276_1197758284 -4 Left 1197758276 X:130011176-130011198 CCTCCTCCTTGGCCACTCCCACC 0: 1
1: 1
2: 7
3: 133
4: 951
Right 1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG 0: 1
1: 0
2: 1
3: 42
4: 337
1197758277_1197758284 -7 Left 1197758277 X:130011179-130011201 CCTCCTTGGCCACTCCCACCCAC 0: 1
1: 0
2: 4
3: 64
4: 621
Right 1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG 0: 1
1: 0
2: 1
3: 42
4: 337
1197758278_1197758284 -10 Left 1197758278 X:130011182-130011204 CCTTGGCCACTCCCACCCACAGC 0: 1
1: 0
2: 6
3: 85
4: 696
Right 1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG 0: 1
1: 0
2: 1
3: 42
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197758284 Original CRISPR CACCCACAGCTCCCAAGGGC AGG Intronic
900814574 1:4833628-4833650 GACTCACAGCTCCAAATGGCTGG + Intergenic
901066216 1:6495971-6495993 CACTCCCAGCTCCCAAGCCCTGG + Intronic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG + Intronic
902617244 1:17630497-17630519 CCCCCACAGCTGCTAAGGCCAGG - Intronic
902644082 1:17786047-17786069 CACCTGCAGCACCCAAGGACAGG - Intronic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
903959098 1:27045400-27045422 GACTGCCAGCTCCCAAGGGCAGG - Intergenic
904548667 1:31297147-31297169 CACCCTCAGCTGAGAAGGGCAGG - Exonic
906353816 1:45085658-45085680 GTTCCACAGATCCCAAGGGCAGG + Intronic
907253050 1:53156020-53156042 CACACTCCCCTCCCAAGGGCTGG + Intergenic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
909167488 1:72247492-72247514 CATCCACAGATCTCTAGGGCAGG + Intronic
909273513 1:73654793-73654815 GACCCACAGCTCCTCATGGCTGG - Intergenic
913292239 1:117284442-117284464 CAGCAACAGTTCCCAAGAGCTGG - Intergenic
915297589 1:154932284-154932306 CAGCCACAGCTCCAAAGTCCTGG + Intronic
915940804 1:160117135-160117157 ACCTCACAGCTCCTAAGGGCAGG - Intronic
916042306 1:160971661-160971683 TACTCACAGTTCCCAAGGGAAGG + Intergenic
916993103 1:170266170-170266192 GACCCACAGTTCCACAGGGCTGG + Intergenic
917709070 1:177666079-177666101 CACCCACAGGTCTAAAGGGGCGG - Intergenic
917969687 1:180198742-180198764 CACCCCCTGCTCCCTTGGGCTGG + Exonic
919056062 1:192570656-192570678 CTACCACAGGTCCCTAGGGCAGG + Intergenic
922355895 1:224774642-224774664 CACCCACAGTTCCCCAGAGGAGG - Intergenic
922422161 1:225467462-225467484 CACCCACAGCTGCAGAGAGCCGG + Intergenic
922749603 1:228064377-228064399 CTCCCTCACCTGCCAAGGGCAGG + Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923226537 1:231943247-231943269 TACTCACAGTTCCCAAGGGCTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924422683 1:243924207-243924229 TACCCACAGCACAAAAGGGCTGG - Intergenic
924550098 1:245067889-245067911 CTCCCCCATCTCCCAAAGGCAGG - Intronic
1063502017 10:6563822-6563844 CACTGTGAGCTCCCAAGGGCAGG - Intronic
1063769527 10:9182214-9182236 GACCCACAGATCCCCATGGCTGG + Intergenic
1065318176 10:24484844-24484866 CCCCCTCAGATCCGAAGGGCTGG - Intronic
1065971952 10:30812585-30812607 CAGCCTCAGCTCCAATGGGCGGG + Intergenic
1067284199 10:44895487-44895509 CAGCCACAGCTCCCTTGGGAGGG - Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069584286 10:69587201-69587223 GACCCACAGTTCCAAATGGCTGG - Intergenic
1069890070 10:71647023-71647045 CACCCCCAGCTGCCCATGGCTGG + Intronic
1072907098 10:99464557-99464579 CACCTCCACCTCCCAAGTGCTGG + Intergenic
1073426777 10:103459793-103459815 CTCCCTGACCTCCCAAGGGCAGG + Intergenic
1074895409 10:117773153-117773175 CCCCCACAGCTTCCAAGTGCTGG + Intergenic
1076020676 10:127070212-127070234 CATTCACAGGTCCCAAGGGTTGG + Intronic
1076173227 10:128340666-128340688 CACACTCAGCTCCCAGGTGCTGG + Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1076640840 10:131916203-131916225 CACACACAGCACCCAGAGGCGGG + Intronic
1076897716 10:133321788-133321810 CACCCACAGATCACAAGGTCAGG - Intronic
1077554108 11:3217805-3217827 TACCCTGAGCACCCAAGGGCTGG - Intergenic
1079729420 11:23921400-23921422 CAGCCACAGCTGCCAGGGGTGGG + Intergenic
1080577629 11:33614502-33614524 CACTCACAGATCCCAAGAGGAGG - Intronic
1080647888 11:34200015-34200037 CACCCATGGAGCCCAAGGGCAGG - Intronic
1080740097 11:35055839-35055861 GACTCACAGCTCCGCAGGGCTGG - Intergenic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1085187991 11:74592592-74592614 CAGCCACAGCTCCCGCCGGCGGG - Exonic
1085219292 11:74859826-74859848 CACATTCAGCTCCCACGGGCAGG - Intronic
1086243252 11:84720998-84721020 CACCAAGAGCGCCCAAAGGCAGG - Intronic
1090385642 11:126356210-126356232 CACAGTCAGCTCCCAAGTGCTGG - Intronic
1090623008 11:128578191-128578213 CACCCAAAGCTTGCCAGGGCAGG + Intronic
1091165175 11:133469023-133469045 CAACCCCAGCTCCTCAGGGCAGG - Intronic
1091656032 12:2347656-2347678 CTCCCACAAATCCCAAAGGCAGG - Intronic
1094002132 12:25706844-25706866 CTTCCACAGATCCCTAGGGCAGG - Intergenic
1094682638 12:32679565-32679587 CTCCCACAGGCCCCAAAGGCTGG - Intronic
1097084020 12:56454316-56454338 CAGCCACAGCTCCCAGGAGCTGG + Exonic
1102047683 12:109840038-109840060 CAACCACCCCTCCCATGGGCAGG + Intergenic
1103149274 12:118622853-118622875 TACCCACAGATCCCAAGTGGAGG - Intergenic
1103599265 12:122043830-122043852 ATCCCACAGCTGCCAAGGACGGG - Intronic
1104064246 12:125293790-125293812 CCCCCACACCTCTCAAGGGGTGG - Intronic
1104458887 12:128937860-128937882 GACTCACAGCTCCAAAGGGCTGG - Intronic
1104466803 12:128997059-128997081 CACTCACAGTTCCCAAGAGGAGG + Intergenic
1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG + Intergenic
1104599487 12:130142824-130142846 CACCCTCAGCTACCCTGGGCCGG + Intergenic
1104599967 12:130146130-130146152 CACCCCAACCTCCCAAAGGCTGG - Intergenic
1104624362 12:130339228-130339250 CCTCCACAGGTGCCAAGGGCCGG - Intronic
1104964550 12:132503043-132503065 CCTCCATAGCTCCCAAGGGGTGG + Intronic
1105028800 12:132868755-132868777 CACACGCAGCTGCCAGGGGCTGG + Intronic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1107444463 13:40457843-40457865 CAACCAGGGATCCCAAGGGCTGG - Intergenic
1107917488 13:45167798-45167820 CTCCCAAACCTCCCAAGTGCTGG + Intronic
1110124999 13:71931678-71931700 GACTCACAGTTCCCCAGGGCTGG - Intergenic
1110544824 13:76744567-76744589 TAACCCCAGATCCCAAGGGCAGG + Intergenic
1111505535 13:89184254-89184276 CTTCCACAGATCTCAAGGGCAGG + Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1113087286 13:106581487-106581509 CACCCTGAGCTCACAAAGGCTGG - Intergenic
1119586854 14:75843972-75843994 CAACCACACCTCCCAAGTTCAGG + Intronic
1119871742 14:78023645-78023667 CCCCCACTGCTACCCAGGGCAGG - Intergenic
1120865461 14:89292328-89292350 CACTCACAAATCCCAAGAGCTGG + Intronic
1121302899 14:92886000-92886022 CACCCACGGCCACCAAGGTCAGG - Intergenic
1122209415 14:100165421-100165443 CACTCACAGTTCTCAAGAGCAGG - Intergenic
1122363330 14:101180251-101180273 CATTCACCGGTCCCAAGGGCTGG - Intergenic
1122802112 14:104236637-104236659 TACTCACAGCTCCCAAGAGGAGG + Intergenic
1123020481 14:105395680-105395702 CACCCACGGCTCCAAAGTGCCGG - Exonic
1123051298 14:105545443-105545465 AACCCCCAGGTCCCAAGGCCTGG + Intergenic
1123076710 14:105671145-105671167 AACCCCCAGGTCCCAAGGCCTGG + Intergenic
1123171082 14:106373536-106373558 CGCCCACAGATCCCGAGGCCGGG - Intergenic
1123948837 15:25251799-25251821 CACCCACCATGCCCAAGGGCAGG + Intergenic
1124004608 15:25785849-25785871 CACCCACCTCGCCCAGGGGCAGG + Intronic
1125794907 15:42396970-42396992 AGCCCAGATCTCCCAAGGGCTGG - Intronic
1128125474 15:65189223-65189245 TACCTCCAGCCCCCAAGGGCAGG - Intergenic
1128358476 15:66944355-66944377 CCACCACAGCTCCAAAGGCCAGG + Intergenic
1128382349 15:67122341-67122363 CACCCACAGCTGACAGGGTCTGG - Intronic
1128637378 15:69311793-69311815 CACCCACATTTCCCAAGAGGAGG - Intronic
1129160849 15:73746872-73746894 CACCAGAAGCTCCCAAAGGCAGG - Intronic
1129161902 15:73752179-73752201 CCCCCAAGGCTCCCTAGGGCGGG + Exonic
1129752500 15:78076156-78076178 CCCCCAGAACTCCCAAGGACAGG + Intronic
1129945663 15:79537565-79537587 CACCCAAAGCTCAGAAGAGCAGG + Intergenic
1130768408 15:86898019-86898041 CACCCACACCTACCGAGTGCTGG + Intronic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131179230 15:90228753-90228775 GCCCCAAGGCTCCCAAGGGCCGG - Exonic
1131456254 15:92584810-92584832 CACCCACACCTCCAAATGGCTGG + Intergenic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1132581468 16:686597-686619 CACCCTCAGCTACCAAGGCAAGG + Intronic
1132603738 16:785077-785099 GACCCACAGCTCCCAAGCTGGGG + Exonic
1132852512 16:2031199-2031221 GTCCCACAGGTCCCACGGGCAGG - Intronic
1132870008 16:2111770-2111792 CACCCACAGCCACGGAGGGCAGG + Exonic
1133470643 16:6072052-6072074 GACTCACAGCTCCACAGGGCTGG + Intronic
1134066130 16:11229604-11229626 CACCTCCACCTCCCAAGTGCTGG + Intergenic
1134717415 16:16363831-16363853 CACCCACAGCCTCGGAGGGCAGG - Intergenic
1134957337 16:18388328-18388350 CACCCACAGCCTCGGAGGGCAGG + Intergenic
1135179853 16:20263282-20263304 TACCCACAGTTCCCAAGAGGAGG + Intergenic
1135207966 16:20499080-20499102 CTCCCAGGGCTCCCAGGGGCAGG - Intergenic
1135210933 16:20524620-20524642 CTCCCAGGGCTCCCAGGGGCAGG + Intergenic
1135656187 16:24252344-24252366 CTCCCACAACTCACAGGGGCTGG + Intergenic
1135722497 16:24829445-24829467 CCCCCAAACCTCCCAAGGCCCGG - Intergenic
1136417769 16:30113989-30114011 CACTCCCAGCTGCCCAGGGCTGG - Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1139378862 16:66517694-66517716 CACCCACTGCCCCCAAGGGTTGG + Intronic
1141901071 16:86990905-86990927 CACGCACATCTCCCAGGGGATGG + Intergenic
1142114308 16:88348442-88348464 CACCAACAGGTCCCCAGGGTTGG + Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142903299 17:3026618-3026640 CACCCACTGCGCCCAGGGGGTGG - Intronic
1143558124 17:7675171-7675193 AACCCACAGCTGCACAGGGCAGG + Exonic
1144709273 17:17389800-17389822 CACCCACAGCCAGGAAGGGCTGG + Intergenic
1146307076 17:31738566-31738588 CAACTGCAGCTCCCAAGTGCAGG + Intergenic
1146662353 17:34673271-34673293 CAGCCAGAGAGCCCAAGGGCTGG - Intergenic
1146679639 17:34797829-34797851 CTCGCACAGTTCCCAAGGTCTGG + Intergenic
1147557458 17:41488566-41488588 CATCACCAGCTCCCAAAGGCAGG + Intronic
1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG + Intronic
1148215563 17:45832397-45832419 CACACACAGCTTCTGAGGGCCGG - Intronic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1150216670 17:63475355-63475377 CACCCACAGCCCTCAAAGCCTGG + Intergenic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152378014 17:79928659-79928681 CACCCTCACCTCCCAAGGCAAGG + Intergenic
1152608809 17:81305804-81305826 CTCCTACAGCTCCCAGGGCCGGG - Intergenic
1155407681 18:25507187-25507209 TGCCCAGAGCTCACAAGGGCTGG + Intergenic
1156530028 18:37806150-37806172 CACACCAAGCTCCCAGGGGCAGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157859121 18:51125172-51125194 TACCCACAGTTCCCAAGAGGAGG + Intergenic
1159783993 18:72692677-72692699 CCCCCACTGCTCCCAGGGGAGGG + Intergenic
1159940188 18:74400837-74400859 CACACACAGCACCCAAGAACAGG + Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160838571 19:1136252-1136274 CACACACAGCTTCAAAGGCCAGG - Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161619965 19:5292779-5292801 CAGTCACAGCTCCCCCGGGCTGG + Intronic
1162130186 19:8521591-8521613 CTCCCACAGATCCCTCGGGCTGG - Exonic
1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG + Intergenic
1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG + Intergenic
1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG + Intergenic
1162167969 19:8767175-8767197 CACCCACACATCCCACAGGCAGG + Intergenic
1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG + Intergenic
1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG + Intergenic
1162450420 19:10750990-10751012 CACACACAGCTCCCCAAGGTGGG - Intronic
1162588714 19:11577221-11577243 CACCCACGGCTACAAAGCGCAGG + Exonic
1163197508 19:15733403-15733425 CAGCCACAGCTCTCAAGGCCCGG - Intergenic
1163297864 19:16424090-16424112 CAGCCACAGGTCCCAAAGGAAGG + Intronic
1163360182 19:16841020-16841042 CATCCCCAGCACACAAGGGCTGG - Intronic
1163451439 19:17379557-17379579 CACCCAGAGCCCCCCAGAGCTGG + Intergenic
1164608854 19:29618677-29618699 CACCCACAGCTGCCTAGAGCCGG - Intergenic
1165335914 19:35169557-35169579 CACCCACAGGTGGCAAGTGCAGG + Exonic
1165581876 19:36872412-36872434 CACCCACTGCCCCCCAGGGAGGG - Intronic
1167096004 19:47375455-47375477 CTCCAACAGCTCCTAGGGGCAGG - Exonic
1167729203 19:51241043-51241065 CACCCGCCACTCCCATGGGCAGG - Intronic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
1168349924 19:55669878-55669900 CACCAACATCTCCCATGGCCCGG - Intronic
1168598017 19:57694793-57694815 CGACCACAGCTGCCAAGGGTGGG - Intronic
924972996 2:147891-147913 CACTCACAGCTCCACATGGCTGG + Intergenic
925046410 2:776289-776311 CCCCCGCAGCTGCCAATGGCCGG - Intergenic
925317842 2:2939049-2939071 CCTCCACAGCTCCCAGGGGTGGG - Intergenic
926288225 2:11507701-11507723 CACCCAGAGCCTCCAAGGGCAGG - Intergenic
926583874 2:14663773-14663795 CAGCCACAGCCCCCACTGGCTGG - Intergenic
926840090 2:17070638-17070660 CATCCACAGATCTCTAGGGCAGG - Intergenic
927869553 2:26614915-26614937 CTCTCAAAGCTCCCAAGAGCAGG - Intronic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
928387753 2:30884456-30884478 GACCCACAGCTCTGCAGGGCTGG - Intergenic
929604945 2:43227514-43227536 CACCCCCAGCCCCAGAGGGCTGG - Intergenic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
932055253 2:68436968-68436990 AACCCACTCCTCCCAATGGCAGG - Intergenic
932314228 2:70768742-70768764 GGTCCACAGCCCCCAAGGGCAGG - Intergenic
935015042 2:99173822-99173844 CACACAGAGCTCCAAAGGGCAGG + Intronic
935752191 2:106245419-106245441 CACCCACCGGTCCCAAGTCCAGG - Intergenic
937434730 2:121871018-121871040 CAACCACATCTCCAAAAGGCAGG - Intergenic
937832365 2:126437802-126437824 TACCCACAGATCCCAAGAGAAGG + Intergenic
937984776 2:127633528-127633550 CTTCCAAAGCACCCAAGGGCAGG - Intronic
938261963 2:129902973-129902995 CACAAACAGCTGCCTAGGGCTGG - Intergenic
938372798 2:130783391-130783413 CACCTAGGGCTCCCAAGTGCTGG + Intergenic
938954115 2:136282773-136282795 GACCCACAGCCCAAAAGGGCAGG - Intergenic
939813120 2:146859534-146859556 CAGTCACAGCTCACAGGGGCTGG - Intergenic
940302499 2:152189872-152189894 TTCCCACAGCTCCAAAGGCCTGG + Intergenic
941227547 2:162867856-162867878 CAGCCACCGCTTCCAAGGGGTGG - Intergenic
942124048 2:172805260-172805282 CAGCCCCAGCTCCTAAGGGAGGG - Intronic
942544123 2:177044958-177044980 CACACACGGCTCCCACTGGCTGG - Intergenic
943129654 2:183839858-183839880 CTCCCACACATCCGAAGGGCTGG - Intergenic
944878091 2:203983386-203983408 CAGCCACAGCATCCCAGGGCAGG - Intergenic
946035999 2:216742720-216742742 CTCTCTCAGCTCCCAAGGGAAGG - Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948128719 2:235584393-235584415 CACACACAGCTACCAAGGTTAGG - Intronic
948727929 2:239946087-239946109 CACACACAGCTGCCAAGGTGTGG - Intronic
948900255 2:240953087-240953109 CACACACAGCCCCCAAGAGAGGG + Intronic
1169021277 20:2332900-2332922 CTCCCACAGCTGCCACGGGGTGG + Intronic
1170508711 20:17055174-17055196 CACTCACAGCTTCCCTGGGCAGG + Intergenic
1171421497 20:25020732-25020754 CACACCCAGCCCCCAAAGGCAGG + Intronic
1172269732 20:33647743-33647765 CAACCACAGCCCACAAGAGCAGG - Exonic
1172634299 20:36399537-36399559 CACCCATAGCTCCCCAGTGCTGG - Intronic
1172979248 20:38928413-38928435 CACCCAAAGCACCTCAGGGCTGG - Intronic
1173144858 20:40515708-40515730 TACCTTCTGCTCCCAAGGGCTGG - Intergenic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1174114306 20:48216349-48216371 CACCCACAGCCCCAAAGCCCAGG - Intergenic
1174615526 20:51832551-51832573 AACCCACAGCTCCCATGGGGTGG + Intergenic
1175769710 20:61616051-61616073 CACTCTGAGTTCCCAAGGGCAGG - Intronic
1175998163 20:62820560-62820582 CTCCCAAGGGTCCCAAGGGCAGG - Intronic
1176239322 20:64068603-64068625 CACCCCCAGCTCCCAGCTGCAGG - Intronic
1177208773 21:18043792-18043814 GACCCACAGTTCCACAGGGCTGG + Intronic
1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG + Intergenic
1178829509 21:36044150-36044172 CACCCCCAGAGCCCTAGGGCAGG - Intronic
1179078003 21:38142418-38142440 TACTCACAGTTCCCAAGAGCAGG + Intronic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1179538630 21:42068943-42068965 CCCACACAGCATCCAAGGGCTGG - Intronic
1179899030 21:44379419-44379441 CACCCGCAGCACACCAGGGCGGG + Intronic
1179902743 21:44402400-44402422 CACCCACACCTCCACAGGGAGGG - Intronic
1180857725 22:19058921-19058943 CACCAGCAGCTCCCCTGGGCAGG - Intronic
1181085694 22:20438352-20438374 CACTCAGAGCTCGCAAGGGGCGG + Intronic
1181410008 22:22712167-22712189 CACCCACTGGTCCCATGGTCTGG - Intergenic
1182361564 22:29749473-29749495 CACCCAAGGCTCCCCAGGGAGGG + Intronic
1182629422 22:31673511-31673533 CACCAACTGCTCCCTAGAGCAGG - Intergenic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1184422723 22:44391276-44391298 CTCACACAGCTCCCAGTGGCAGG + Intergenic
1184686204 22:46097507-46097529 CACCCACTGTTCCCGAGGGCTGG - Intronic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
1185024685 22:48401968-48401990 CACCCAGAGGTCGCATGGGCAGG - Intergenic
1185365717 22:50435810-50435832 CAGGGACAGCTCCCCAGGGCAGG + Intronic
949946635 3:9194859-9194881 CACCCAAAGCAGCCAAGGGATGG - Intronic
950429635 3:12943522-12943544 GACCCTCTGCTCCCACGGGCCGG + Intronic
950544175 3:13629098-13629120 CACACACACCTCCCAGGGGTGGG - Intronic
952965936 3:38621278-38621300 CATGCACAGCCCCCCAGGGCTGG - Intronic
953985528 3:47439583-47439605 CACCCACTGCTTACCAGGGCAGG + Intronic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
954747187 3:52793988-52794010 CACCCAGAGCTCCTGGGGGCTGG - Intergenic
954785180 3:53087403-53087425 CACTCACAGCTCCCACCGTCCGG + Intronic
955407178 3:58632921-58632943 GACTCACAGCTCCCAAGTCCTGG - Intergenic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
962206579 3:133440039-133440061 AACCCACAGTTCCCCACGGCTGG + Intronic
962530799 3:136277943-136277965 AACCCATACCTCCCAGGGGCAGG - Intronic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
963710899 3:148746543-148746565 CACACACTGCCCCCAAGGCCAGG + Intergenic
968123607 3:196143039-196143061 CCTCCGCAGCTCCCCAGGGCGGG + Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968871348 4:3244236-3244258 CTCCCACAGCTCCCATCTGCAGG - Intergenic
968956890 4:3724093-3724115 CACCCACGGCCCCCGAGGGTGGG + Intergenic
969929310 4:10614566-10614588 CAGCAGCATCTCCCAAGGGCTGG + Intronic
971074356 4:23130546-23130568 GTCCCACAGCTTCTAAGGGCAGG + Intergenic
972744783 4:41922405-41922427 GACCCACAGTTCCATAGGGCTGG - Intergenic
972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG + Intergenic
973747180 4:53975240-53975262 GACTCACAGTTCCCCAGGGCTGG - Intronic
975419041 4:74140670-74140692 GACCCACAGTTCCACAGGGCCGG + Intronic
976560114 4:86491248-86491270 CACAGACAGCTCCACAGGGCAGG + Intronic
979288170 4:118950344-118950366 TACTCACAGTTCCCAAGGGTAGG + Intronic
981946094 4:150345920-150345942 CTCCCACAGCACCCAATAGCTGG + Intronic
983015456 4:162607345-162607367 CTTCCACAGATCCCCAGGGCAGG - Intergenic
984167439 4:176319872-176319894 CACCCACAGCGCGCACGGGGCGG - Intergenic
984565795 4:181328646-181328668 GACTCACAGCTCCACAGGGCTGG - Intergenic
985512453 5:320511-320533 CAGACACAGCTCCCAAGGTGGGG - Intronic
985529347 5:424665-424687 GCCCCACATCTGCCAAGGGCTGG + Intronic
985631504 5:1016410-1016432 CCCCTCCAGCTGCCAAGGGCTGG - Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986663927 5:10083499-10083521 CACCCACAGCACCAAATGGAAGG + Intergenic
986871202 5:12048832-12048854 GACCCACAGTTCCCCAAGGCTGG - Intergenic
990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG + Intergenic
992198303 5:74361123-74361145 CTCCCTCAGCTCAGAAGGGCTGG - Intergenic
993016796 5:82543839-82543861 CTTCCACAGATCCCTAGGGCAGG - Intergenic
996467898 5:123824893-123824915 GACTCACAGTTCTCAAGGGCTGG - Intergenic
997418385 5:133747173-133747195 TACCCACTGCTGCAAAGGGCAGG - Intergenic
997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG + Intergenic
999085819 5:148888557-148888579 CTCCCACAGCTCCCAACTGTAGG - Intergenic
999685859 5:154102387-154102409 CACCTGCAGCCCCCAGGGGCCGG + Intronic
1001207670 5:169779472-169779494 CACCAACAGCTCACAATCGCAGG - Intronic
1002102440 5:176864105-176864127 CTCCCACTGATGCCAAGGGCAGG + Intronic
1004375877 6:15090248-15090270 CACCCACAAGTCCCGAGGGCAGG + Intergenic
1004557756 6:16716176-16716198 CATCCAAACTTCCCAAGGGCAGG + Intronic
1004565246 6:16789873-16789895 GATCCACAGATCCCTAGGGCAGG + Intergenic
1005597541 6:27393862-27393884 CTTCCACAGATCCCTAGGGCAGG - Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006643413 6:35500029-35500051 CACCCTCAACTTCCAAGGCCGGG - Exonic
1007507495 6:42347240-42347262 CACCCACCTCTCCCAAAGGCAGG + Intronic
1008966987 6:57322629-57322651 GACTCACAGTTCCCCAGGGCTGG - Intronic
1012703151 6:102488824-102488846 CACTCACAGTTCCCAAGAGGAGG + Intergenic
1013684658 6:112565466-112565488 CATGCACACCTCCCAAGTGCTGG - Intergenic
1016712936 6:147194194-147194216 CACGCTCACCTCCCAAGTGCTGG + Intergenic
1016744541 6:147564385-147564407 AATCCACAGGTCCCAATGGCTGG + Exonic
1016907784 6:149168918-149168940 TACTCACAGTTCCCAAGGGGAGG + Intergenic
1017794615 6:157832577-157832599 GACTCACAGTTCCAAAGGGCTGG + Intronic
1017908369 6:158772185-158772207 GGCCATCAGCTCCCAAGGGCAGG + Intronic
1018095880 6:160386686-160386708 CACAGACATCTTCCAAGGGCTGG + Intronic
1018422627 6:163652651-163652673 CACCCATTTCTCCCAAGGGCAGG + Intergenic
1018896110 6:168018723-168018745 CTCCTTCAGCTACCAAGGGCTGG + Intronic
1019211796 6:170412598-170412620 CAGCCACAGCTCACAAGGCAGGG - Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019527606 7:1487708-1487730 CACCCACAGGTCCCGACGGCAGG + Intronic
1019707061 7:2501954-2501976 CACCCACTGCACCCCAAGGCTGG - Intergenic
1020119068 7:5492569-5492591 CACCCTCAGGTCCCAAGGTGAGG - Intronic
1021779083 7:24084269-24084291 CTTCCACAGATCCCTAGGGCAGG + Intergenic
1022441391 7:30436262-30436284 CACACACAGAGCACAAGGGCAGG + Intronic
1022723809 7:32963290-32963312 CACCCAGGCCTCCCAAGGACTGG - Intronic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1024131956 7:46362252-46362274 CATCCACACCTCCCAACTGCAGG + Intergenic
1025049816 7:55724626-55724648 CACCCAGGCCTCCCAAGGACTGG + Intergenic
1025199076 7:56950691-56950713 CACTCGCAGCCCCCCAGGGCTGG - Intergenic
1025672871 7:63626242-63626264 CACTCGCAGCCCCCCAGGGCTGG + Intergenic
1026966950 7:74446164-74446186 GATCCAGAGCTCCCAGGGGCAGG + Intergenic
1027463608 7:78486594-78486616 CACCCACAACTCCCAATCTCGGG - Intronic
1032823845 7:135550385-135550407 CACACACTGCTGCCCAGGGCCGG + Intergenic
1033232960 7:139616072-139616094 CACCCACAGGGGCTAAGGGCTGG - Intronic
1033842910 7:145396942-145396964 GACTCACAGTTCCAAAGGGCTGG + Intergenic
1034707525 7:153158840-153158862 AGCCCACAGCTCCCTAGGGGTGG - Intergenic
1034894751 7:154869296-154869318 CAGACTCAGCTCCCAAGAGCAGG + Intronic
1035392631 7:158515574-158515596 CACCCACTGCTCCCAATGGGAGG + Intronic
1036626006 8:10472045-10472067 CATCCTCACCTCCCAAGTGCTGG - Intergenic
1037528659 8:19752908-19752930 CAGGCACAACTCCCAAGTGCTGG + Intronic
1037826272 8:22162472-22162494 CTCCCACGGCTGCCTAGGGCTGG - Intronic
1037919267 8:22792719-22792741 GGCCAACAGCTCCCATGGGCAGG - Intronic
1040374448 8:46810409-46810431 CACCCCCATCTCCTATGGGCTGG - Intergenic
1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG + Intronic
1043376153 8:79652032-79652054 CAGCCACAGCTGCTAAAGGCAGG - Intronic
1045079113 8:98604930-98604952 GATCCACAGATCCCCAGGGCAGG + Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049542480 8:143214875-143214897 CACCCACTGCTCAGATGGGCGGG - Intergenic
1049828391 8:144685067-144685089 CACCCACACCCACCACGGGCGGG + Intergenic
1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG + Intergenic
1051276530 9:15404333-15404355 AACACTCATCTCCCAAGGGCAGG + Intergenic
1051371659 9:16364399-16364421 CAGCCACAGGCCCCCAGGGCTGG + Intergenic
1052325716 9:27215044-27215066 TACCCACATCCCCCAAGTGCTGG - Intronic
1053571876 9:39318335-39318357 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1053915137 9:42940054-42940076 CTGCCACAGCTCTCATGGGCTGG + Intergenic
1054093430 9:60877046-60877068 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054114913 9:61152966-61152988 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054125269 9:61300676-61300698 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1054592843 9:67029568-67029590 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG + Intergenic
1058618228 9:106858951-106858973 CACCCAAATCTCCCAAAGGAAGG - Intergenic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1061390730 9:130315807-130315829 CACCCATAGGTCCCAAGGAAAGG - Intronic
1061873086 9:133531044-133531066 CACCCACAGTGACCAGGGGCGGG - Intergenic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1185779213 X:2830127-2830149 CACCCACTGCTCCCGGGCGCAGG + Exonic
1186069909 X:5808429-5808451 GACTCACAGCTCCCCATGGCTGG + Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1187505536 X:19875542-19875564 CACCCACTCCTCCACAGGGCAGG + Intronic
1188195069 X:27222916-27222938 AACCCACATCTGCCAAGGGCGGG - Intergenic
1188531505 X:31146004-31146026 CTCCCACATCTCTCAAGTGCAGG + Intronic
1188788405 X:34377737-34377759 CAAGCACAGAACCCAAGGGCAGG - Intergenic
1190117399 X:47635651-47635673 AACCCCCAGGTCCCAAGGCCTGG + Exonic
1190542718 X:51495637-51495659 CACACACACCTCCCAAAAGCAGG + Intronic
1191723107 X:64251220-64251242 GACCCATAGACCCCAAGGGCAGG - Intergenic
1193593913 X:83422632-83422654 GTTCCACAGCTCCCTAGGGCTGG - Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1199010599 X:142754059-142754081 CACCCACAGACCCCAAGTTCAGG - Intergenic
1199329624 X:146543573-146543595 CTTCCACAGATCCCCAGGGCAGG + Intergenic
1199713623 X:150490181-150490203 CACCCACAACTACCAATGGAAGG - Intronic
1200144380 X:153918963-153918985 CACCCAAGCCTCCCAAGTGCAGG - Exonic
1200299073 X:154954184-154954206 CACCCTCAACTCCCAAGCCCTGG - Intronic
1201509022 Y:14736817-14736839 AACCCACAGTTCCACAGGGCTGG - Intronic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic