ID: 1197758467

View in Genome Browser
Species Human (GRCh38)
Location X:130012326-130012348
Sequence CAGGGTAAACAGTCCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197758460_1197758467 5 Left 1197758460 X:130012298-130012320 CCACACTCCTGGCAAGAGCCCTA 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1197758467 X:130012326-130012348 CAGGGTAAACAGTCCAAAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 205
1197758461_1197758467 -2 Left 1197758461 X:130012305-130012327 CCTGGCAAGAGCCCTAGAAAACA 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1197758467 X:130012326-130012348 CAGGGTAAACAGTCCAAAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197758467 Original CRISPR CAGGGTAAACAGTCCAAAGA GGG Intronic
901522217 1:9793827-9793849 CAGGCAAAACAGTGCAAAGTTGG + Intronic
906319866 1:44809148-44809170 CAGGGGCCAAAGTCCAAAGAAGG - Intronic
911012121 1:93291329-93291351 CAGTGAAAACAGTACTAAGAGGG + Intergenic
913255139 1:116945977-116945999 CAGTGTAAAGAGACCAAGGAAGG + Intronic
914830980 1:151170696-151170718 GATGGTAAACAGCCCAGAGAGGG - Intronic
917713839 1:177713453-177713475 CAGGGTAAATAGTCAACAAATGG + Intergenic
918187469 1:182141078-182141100 CAGGGAAAACAGCACAGAGAAGG + Intergenic
920416115 1:205800327-205800349 CAGGGTCAAGAGTCTAGAGAAGG - Intronic
920790600 1:209086536-209086558 GAGGATAATTAGTCCAAAGAAGG + Intergenic
1063006595 10:1977458-1977480 CAGGGCATACAGTATAAAGACGG - Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063588410 10:7373552-7373574 CAGGGTCAGGAGTCCAAAGCTGG + Intronic
1064797050 10:19024333-19024355 TAGGGTAAACAACCCATAGATGG + Intergenic
1065427820 10:25623675-25623697 CAGGGCAATCAGGCAAAAGAAGG + Intergenic
1070238892 10:74658370-74658392 AAAGGTAGACAGTCCATAGATGG + Intronic
1070467519 10:76738603-76738625 CAGGGAAAACACTCCAAGCATGG - Intergenic
1070523328 10:77274095-77274117 CATGGTAAACAGTGGCAAGAGGG - Intronic
1070771336 10:79084189-79084211 CAGGGGAGAGAGTTCAAAGATGG - Intronic
1071584013 10:86801691-86801713 CAGGTTAAACAGTTGAAAGAAGG - Intronic
1072808613 10:98443094-98443116 CAGGGTAGGCAGTCCCAGGAGGG - Intronic
1074454089 10:113582291-113582313 CATGGTAAACATTCCAGACATGG - Intronic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1079736034 11:23998531-23998553 CAGAGCAATCAGGCCAAAGAAGG + Intergenic
1082874358 11:57972814-57972836 CAGCATACACAGTGCAAAGAGGG - Intergenic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1083446203 11:62709439-62709461 AAAGGTAAACAGGCCGAAGAGGG + Intronic
1084368925 11:68725000-68725022 AAGGGAAAAGAGTACAAAGATGG + Intronic
1085654657 11:78302240-78302262 CAGAGTAAACAGGCCAGAGTGGG + Intronic
1086280130 11:85175610-85175632 CAGGGCAAACAGGCAACAGAAGG + Intronic
1087328461 11:96751890-96751912 CAGGGCAATCAGGCAAAAGAAGG - Intergenic
1088227266 11:107635014-107635036 CAGGGGAGACAGTGCTAAGAGGG - Intronic
1089761848 11:120732519-120732541 CAGTGAAAACAGTACTAAGAGGG - Intronic
1090906391 11:131078341-131078363 CAGGGTAAGCATTCCCATGACGG + Intergenic
1091276151 11:134352581-134352603 CAGTGAAAGCAGTGCAAAGAGGG - Intronic
1094274873 12:28661829-28661851 CAGTGTAAACAGTGCTAACAGGG + Intergenic
1094408717 12:30147239-30147261 CAGGAAAAACTGTCCTAAGATGG + Intergenic
1094464925 12:30742937-30742959 CAGGATACACAGTCCTCAGAGGG + Intronic
1094478012 12:30856613-30856635 CAGTGTAATCCGTCCAAATAAGG + Intergenic
1095193359 12:39284440-39284462 CACTGTAATCATTCCAAAGATGG + Intergenic
1095801229 12:46271345-46271367 CAGGTTAAACACTTCACAGATGG + Intergenic
1096182537 12:49558597-49558619 CAGGGGAAACAGGCCGGAGAGGG + Intronic
1096849562 12:54426967-54426989 CAGGGAAATAAATCCAAAGATGG - Intergenic
1098410540 12:70178466-70178488 AAGGATAAATAGTCCAATGAAGG - Intergenic
1099130744 12:78827343-78827365 GAGAGTAAACAGTCTACAGAAGG - Intergenic
1100786016 12:98079553-98079575 AAAGGTAAACTGTCAAAAGAAGG - Intergenic
1101648849 12:106656515-106656537 CAGGGTTAACATCCCAAACAGGG + Intronic
1104618916 12:130294807-130294829 CAACTTAAATAGTCCAAAGATGG + Intergenic
1107523775 13:41209930-41209952 CAGTGAAAACAGTACTAAGAGGG - Intergenic
1108705145 13:52978620-52978642 CAGAGTAAAGAGGCCAAAAAAGG - Intergenic
1108821102 13:54351139-54351161 AAGGGTATACAGTCCAGAAAGGG - Intergenic
1109804275 13:67417621-67417643 CAAGGTAAATAGTGCAAAAAAGG + Intergenic
1110308577 13:74020351-74020373 CAGGGCAAACCCTACAAAGATGG + Intronic
1111683411 13:91471687-91471709 CAGGATAAAGAGTCAAAACAAGG - Intronic
1118969799 14:70625065-70625087 CAGTGAAAACAGTGCTAAGAGGG + Intergenic
1119004774 14:70914059-70914081 AAGGGTACACTGTCCAAAGATGG + Intronic
1119610771 14:76060066-76060088 CAGGGAAAACAGTACTAACAAGG + Intronic
1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG + Intergenic
1121072691 14:91038969-91038991 CAGGGTACACTGTGAAAAGAGGG - Intronic
1126480063 15:49109523-49109545 AAGAGTAGACAGTCCATAGAAGG + Intronic
1130868078 15:87949126-87949148 CAGGGAAAACACTGCAAAGAGGG + Intronic
1131011119 15:89019280-89019302 CAGGGTCAACAATGCAAAGCAGG + Intergenic
1131558886 15:93422585-93422607 CAGGATTCACAGTCCAGAGACGG - Intergenic
1133026843 16:2992311-2992333 CAGGGGAAACAGTCAAGATAGGG - Intergenic
1133309122 16:4831519-4831541 AAGGGTAGGCATTCCAAAGATGG - Intronic
1135297403 16:21294273-21294295 CAGGGAAAACGGTCCAAAACTGG - Intronic
1136684553 16:31986574-31986596 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1136785179 16:32930117-32930139 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1136884603 16:33923687-33923709 CTGGGAAAACAGCCCAGAGAGGG - Intergenic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1141209758 16:81966588-81966610 TAGGGAAAACACTCTAAAGAGGG + Intergenic
1203087839 16_KI270728v1_random:1194126-1194148 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1147145485 17:38482255-38482277 CTGGGAAAACAGCCCAGAGAGGG + Intronic
1150518394 17:65838493-65838515 CAGGAAAATCAGTTCAAAGAGGG + Intronic
1150993026 17:70282741-70282763 GAGGGTCATCAGTGCAAAGACGG + Intergenic
1157016672 18:43723190-43723212 CAGGGAAATCAGGCAAAAGAAGG + Intergenic
1158677866 18:59538638-59538660 AAGAGTAAACAGTCAAAAGTGGG + Intronic
1160138204 18:76293237-76293259 CAGTGAAAACAGTACTAAGAGGG - Intergenic
1164438013 19:28249165-28249187 CAGTGCAAACAGTCCACATATGG + Intergenic
1166255829 19:41603839-41603861 CAGGGTACACAGACTACAGATGG + Intronic
927096346 2:19750298-19750320 CAGGGCTACCAGTCCAAGGAAGG + Intergenic
936167358 2:110133868-110133890 CAGTGAAAACAGTCCTAAGAGGG + Intronic
936169808 2:110159938-110159960 CAGGTTAAACAGTACTTAGATGG - Intronic
936328053 2:111522579-111522601 AAGTGTAAACAGTGCAAAGCTGG + Intergenic
936898007 2:117450574-117450596 CAAGGTAAACAAGCCAAAAAAGG + Intergenic
937270362 2:120647055-120647077 AAAGATAAACAGTCAAAAGATGG - Intergenic
938025153 2:127941152-127941174 CAGGGTAAACATTTCAGTGAGGG + Intergenic
941373390 2:164696168-164696190 CAGAATAAACACTCCATAGAAGG + Intronic
942401146 2:175604743-175604765 CTGGGCAAATAGTCCAAAGAGGG + Intergenic
942661382 2:178268906-178268928 TGGGGCAAAAAGTCCAAAGATGG - Intronic
943211933 2:184977868-184977890 CTGGTTAAACTGTACAAAGAGGG - Intergenic
943237114 2:185337153-185337175 CACGGAAAACCTTCCAAAGAAGG - Intergenic
944503889 2:200390110-200390132 CATGGTTTACAGTCCAGAGAAGG - Intronic
946336287 2:219038777-219038799 CAGGGAAGGCACTCCAAAGAGGG + Intronic
1171362261 20:24596107-24596129 CAGCTAAAACAGTGCAAAGAGGG - Intronic
1172987085 20:39000332-39000354 AAGAGTAAACAGTTCACAGAAGG - Intronic
1173471858 20:43330185-43330207 GAGGGGAAAAAGTCCAAAGAGGG - Intergenic
1174594158 20:51670183-51670205 TAGGGCAAACTCTCCAAAGATGG - Intronic
1174605481 20:51758475-51758497 AAGGGACAAAAGTCCAAAGATGG + Intronic
1175019024 20:55824861-55824883 CAGGGTGAAGAGGCCAAGGATGG + Intergenic
1177627921 21:23688666-23688688 CCTGGTAAACAGTCCCAATATGG + Intergenic
1178305895 21:31489755-31489777 CAGGGCAGACAGTCCCCAGAGGG + Intronic
1181087309 22:20447188-20447210 GAGGGTAAAAAGCCCACAGAAGG - Intronic
1183761897 22:39828244-39828266 CAGGGTAAAGAGTACAGAGCAGG - Intronic
1184602535 22:45552125-45552147 CTGGGTAGACAGCCCACAGAGGG + Intronic
1185294599 22:50046907-50046929 CAGGGCACAGAGGCCAAAGATGG - Intronic
949406219 3:3717485-3717507 CAGGGAGAACACTGCAAAGATGG + Intronic
951067675 3:18286404-18286426 AAGGGTAAACAGAGCATAGAAGG + Intronic
952027010 3:29095381-29095403 CAGGGCAATTAGTCAAAAGAAGG - Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
953717478 3:45328453-45328475 TAGGGTAAGCAGTCTACAGATGG - Intergenic
959765058 3:110016479-110016501 CAAGGTGAACAGAACAAAGAAGG - Intergenic
960785245 3:121365912-121365934 CAGTGAAAGCAGTGCAAAGAGGG - Intronic
961531592 3:127543616-127543638 CAGAGGAAACAGTCCAACAATGG - Intergenic
962592150 3:136902002-136902024 CAGCAAAAACAGTGCAAAGAGGG - Intronic
963571825 3:147007946-147007968 CATGGAAAACATTCCTAAGAAGG - Intergenic
964861972 3:161212791-161212813 AAAGGTAAACAGTCCAGAGTTGG + Intronic
965632998 3:170752483-170752505 CAAGGGAAAGATTCCAAAGAGGG - Intronic
965737900 3:171841267-171841289 CATGTTAAACAGTACAAAGATGG - Intergenic
966422213 3:179744959-179744981 CAGGGAAGACTGTCCAAAGAGGG + Intronic
972255482 4:37350677-37350699 CAGGGCAATCAGGCAAAAGAAGG - Intronic
974330036 4:60466425-60466447 CAGGGTAATCAGGCAGAAGAAGG + Intergenic
974469946 4:62305754-62305776 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
975630070 4:76391519-76391541 CAGTGAAAGCAGTACAAAGAGGG + Intronic
975876932 4:78852017-78852039 AAGGGTAAAAATTCCAAAAAAGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977418071 4:96761083-96761105 CAGGAAAAACAGTGCTAAGAGGG - Intergenic
977771097 4:100861609-100861631 CAGTGAAAGCAGTGCAAAGAAGG - Intronic
978939474 4:114419261-114419283 CAGGATATTCACTCCAAAGAGGG + Intergenic
979143108 4:117203213-117203235 CTGGGTATACAGACAAAAGAGGG + Intergenic
979569681 4:122205269-122205291 CAGGGTAAGCACTCCACAAATGG - Intronic
980071067 4:128243307-128243329 CAGAGTCATCAGTCCAAAGATGG + Intergenic
981461826 4:145021725-145021747 CAGAGTAAACAGCCCAGAGTGGG + Intronic
985040140 4:185882755-185882777 CAGGATAGAGAGTCCAAAAAAGG + Intronic
986180435 5:5388008-5388030 CAGAGTAGACAGTCCAGAAACGG + Intergenic
986538975 5:8824401-8824423 CAAGGTAAACAGTCTACAAAGGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988303327 5:29462683-29462705 CTTGGTAAACATTCCAAAGCTGG - Intergenic
988674830 5:33421635-33421657 CAGGGAAAGCAGAACAAAGATGG + Intergenic
989843275 5:46108218-46108240 CAGGGTAATCAGGCAGAAGAAGG - Intergenic
990794689 5:59526157-59526179 CAGGGCAAGCAGTCCTAGGAAGG + Intronic
990939179 5:61184168-61184190 CAGGATAAAAAGTCCTTAGAGGG + Intergenic
993113192 5:83684857-83684879 CAAAGTACACAGTACAAAGAGGG + Intronic
993494356 5:88590740-88590762 CAGGGCAATCAGGCAAAAGATGG + Intergenic
993673728 5:90793185-90793207 AAGGCTAAACAGTACAAAAATGG + Intronic
997564756 5:134878302-134878324 CAGGTTAAACACTCCATAAATGG - Intronic
997680077 5:135744056-135744078 TAAGGTAAACATTCAAAAGAGGG - Intergenic
998478568 5:142442257-142442279 CAGGGAAGACTGTCCAGAGATGG + Intergenic
998628862 5:143876324-143876346 GATGGTACAGAGTCCAAAGAAGG + Intergenic
1004417689 6:15439490-15439512 CAGCTTAAACCCTCCAAAGAAGG - Intronic
1007823515 6:44579925-44579947 CAGGTTAAACTGTCCAAGCAAGG + Intergenic
1009214882 6:60909815-60909837 CAGTAAAAACAGTACAAAGAGGG - Intergenic
1009262695 6:61514782-61514804 CAGGATAAAAAGTACAAGGAAGG + Intergenic
1011336629 6:86268526-86268548 CAGGGCAATCAGGCCAGAGAAGG - Intergenic
1011423167 6:87196389-87196411 AAAAGTAAACAGTCAAAAGAGGG - Intronic
1011921001 6:92577284-92577306 CAGTGCAAACAGTCCAGAGGAGG + Intergenic
1012488724 6:99753131-99753153 CTGGGAACACAGTCCACAGAGGG + Intergenic
1013832878 6:114295405-114295427 GAGGGTAATAAGACCAAAGATGG + Intronic
1014337730 6:120158909-120158931 CAGAGGAAACAGACCAATGAAGG - Intergenic
1014385562 6:120797694-120797716 CAGGGTAATCAGGCCAGAGAAGG - Intergenic
1015004551 6:128263222-128263244 CTTGGTAAAAAGTCCTAAGAAGG + Intronic
1015862266 6:137693136-137693158 CTGGGTCAACAGGCCAAGGAGGG + Intergenic
1015927104 6:138321724-138321746 CTGGGTATATACTCCAAAGAAGG + Intronic
1016121612 6:140349407-140349429 CAGAGTGAATACTCCAAAGATGG + Intergenic
1017604791 6:156122458-156122480 ATGGGAAAACAGTTCAAAGAAGG - Intergenic
1018626307 6:165782014-165782036 AAGGTAAAAAAGTCCAAAGAAGG + Intronic
1020048823 7:5066836-5066858 CTGGGTAAACAAAACAAAGATGG + Exonic
1021020564 7:15593222-15593244 CAAGGTAATGAGACCAAAGATGG + Intergenic
1022310376 7:29191374-29191396 CAGGGAAAACTTTCCAGAGAAGG + Intronic
1024669765 7:51583895-51583917 AAGATTAAACAGACCAAAGAAGG + Intergenic
1024847881 7:53670910-53670932 TAGAGAAAACAGTGCAAAGAGGG - Intergenic
1026052090 7:66955463-66955485 CAGGGAAACCAGTCAAAAAAGGG - Intronic
1027331145 7:77094957-77094979 AAGGGAAAACAGTCAAAATAAGG + Intergenic
1028891350 7:95991727-95991749 CAGGGACAAGAGTCCAAAGAGGG - Intronic
1029784627 7:102776373-102776395 AAGGGAAAACAGTCAAAATAAGG - Intronic
1030880992 7:114879487-114879509 CAGGGAAAACAGTACTAAGAGGG - Intergenic
1032022729 7:128418857-128418879 CAGAGAGAACAGTCCAAGGAGGG + Intergenic
1032099648 7:128963281-128963303 TAGGGGAAACCCTCCAAAGATGG - Intronic
1033237537 7:139650024-139650046 CAGGGAAGACAGTTCTAAGATGG + Intronic
1034913382 7:155016798-155016820 CAGGGTAAGGAGTACAAACAAGG + Intergenic
1039235869 8:35502232-35502254 CTGGATAAACAGTCCAATGGTGG + Intronic
1041519863 8:58743606-58743628 CATAGTAAACAGTTCAATGACGG - Intergenic
1041765400 8:61413440-61413462 CAGGGGAAAGAGTCCAGAGATGG + Intronic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1042680461 8:71377892-71377914 CAGGGAGAACATTTCAAAGAGGG - Intergenic
1042901215 8:73730167-73730189 CAGTGAAAACAGTCCTGAGAGGG - Intronic
1043859636 8:85300923-85300945 CAGGGGAAATATTTCAAAGAAGG - Intergenic
1045819950 8:106324696-106324718 CAGGGTAAGCACTCAACAGATGG - Intronic
1046961527 8:120118090-120118112 GGGGGAAAACTGTCCAAAGAAGG + Intronic
1047033410 8:120909006-120909028 CAGAGTAAACAGTCTACAGATGG + Intergenic
1048502112 8:134987814-134987836 CAGGGCAAACAGTACAGAGGTGG + Intergenic
1050406807 9:5317589-5317611 CATTGTAATCAGTCAAAAGATGG + Intergenic
1051931170 9:22388212-22388234 TGGGGAAAACAGGCCAAAGAAGG - Intergenic
1052495555 9:29219229-29219251 CAGGCTCAACAGGCCAAAAACGG + Intergenic
1052686256 9:31761049-31761071 CAGCAAAAACAGTGCAAAGAAGG - Intergenic
1053888070 9:42659826-42659848 CAGGGCAATCAGACAAAAGAAGG - Intergenic
1054227090 9:62467276-62467298 CAGGGCAATCAGACAAAAGAAGG - Intergenic
1054234338 9:62543609-62543631 CAGCCTCCACAGTCCAAAGAGGG - Intergenic
1054351331 9:64019164-64019186 CAGAGTAATCAGACAAAAGAAGG - Intergenic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1055425463 9:76191277-76191299 AAGGGGAAACATTCAAAAGAAGG - Intronic
1056024860 9:82483338-82483360 CAGAATATACAGTCTAAAGAAGG - Intergenic
1057309312 9:93931872-93931894 GAGGGTAAATAGTCCACAGATGG - Intergenic
1061378617 9:130240920-130240942 CAGTGTAAATGGTCCAAAGCTGG - Intergenic
1188281060 X:28269898-28269920 CAGGGTAAGGAGTCCTAAGTTGG - Intergenic
1188915654 X:35906815-35906837 CAGGGAAAGCAGTACTAAGAGGG - Intergenic
1189651972 X:43199793-43199815 CAGGGCAATCAGGCAAAAGAAGG - Intergenic
1191907267 X:66107161-66107183 CAGAGTAAACAGTGTAGAGAAGG - Intergenic
1192959777 X:76115804-76115826 CAGTGAAAGCAGTACAAAGAGGG + Intergenic
1194431751 X:93816262-93816284 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
1194722593 X:97357574-97357596 CAGGGTAAAATGTGCTAAGATGG - Intronic
1194989641 X:100533199-100533221 CAGGAAAAGCAGTCCTAAGAGGG - Intergenic
1196012578 X:110904454-110904476 CAGGGTACACCGTTCCAAGATGG - Intergenic
1196126463 X:112106061-112106083 CATGATAAAAACTCCAAAGAAGG - Intergenic
1196324311 X:114384353-114384375 CAGGGGAAAGAGTGCAAACAAGG - Intergenic
1197758467 X:130012326-130012348 CAGGGTAAACAGTCCAAAGAGGG + Intronic
1198926706 X:141804791-141804813 CTGGGTCAGGAGTCCAAAGATGG - Intergenic
1199196209 X:145033701-145033723 CAGTAAAAACAGTACAAAGAGGG - Intergenic
1200380474 X:155832278-155832300 CATGCTAAACAGTCAAAAGCAGG + Intergenic
1200854921 Y:7927301-7927323 AAGTGAAAACAGTACAAAGATGG - Intergenic
1202264552 Y:23004316-23004338 CAAGTAAAACAGTACAAAGATGG + Intronic
1202417543 Y:24638058-24638080 CAAGTAAAACAGTACAAAGATGG + Intronic
1202453243 Y:25032028-25032050 CAAGTAAAACAGTACAAAGATGG - Intronic