ID: 1197760423

View in Genome Browser
Species Human (GRCh38)
Location X:130024235-130024257
Sequence AGGGGGAAGCGCTTGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197760419_1197760423 -4 Left 1197760419 X:130024216-130024238 CCTGGGGTGGTGGGGGAGGAGGG 0: 1
1: 2
2: 22
3: 213
4: 1822
Right 1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG 0: 1
1: 0
2: 0
3: 18
4: 169
1197760416_1197760423 0 Left 1197760416 X:130024212-130024234 CCATCCTGGGGTGGTGGGGGAGG 0: 1
1: 1
2: 13
3: 92
4: 663
Right 1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG 0: 1
1: 0
2: 0
3: 18
4: 169
1197760412_1197760423 5 Left 1197760412 X:130024207-130024229 CCAATCCATCCTGGGGTGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 170
Right 1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG 0: 1
1: 0
2: 0
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197760423 Original CRISPR AGGGGGAAGCGCTTGCCCAG CGG Intronic
900289556 1:1918120-1918142 AGGGGCAACCGCATGCCCAGTGG + Exonic
900686732 1:3953575-3953597 AGAGGGAAGCGGGTGCTCAGGGG - Intergenic
900796420 1:4711378-4711400 GGGGAGAGGCGCTTCCCCAGTGG + Intronic
901175949 1:7299318-7299340 AAGGCGAAGCTCTTGCTCAGAGG - Intronic
902148392 1:14422346-14422368 AAGGGGAAGCTCTTCCCCACTGG - Intergenic
902822546 1:18952003-18952025 AGAGGGCAGCGGTTGGCCAGAGG + Intronic
903072088 1:20731682-20731704 AGCGGGAAGCGCTGTTCCAGGGG + Intronic
903297032 1:22350535-22350557 AAGGGGAGGGGCTGGCCCAGGGG + Intergenic
903891387 1:26572627-26572649 AGGCGGACGCTCTTGGCCAGGGG + Intronic
904245131 1:29181994-29182016 TGGGGGAGGAGCTTGCCCGGGGG + Intergenic
904357481 1:29949969-29949991 AGGAGGAAGCTGATGCCCAGAGG - Intergenic
904827212 1:33281382-33281404 AGGAGGAAGCTCTTGCCTGGGGG - Intronic
906545999 1:46619889-46619911 AGGGGCAAGGGCTTTCCCAAAGG - Intergenic
911224582 1:95291156-95291178 AGGGGGAAGAGCTTTCCAAACGG - Intergenic
913051049 1:115116663-115116685 CGGGGGAAGAGTTTGCCCAAGGG - Intergenic
913326766 1:117634707-117634729 AGGGGGAGGGTCTTGCCCTGAGG - Intergenic
915054313 1:153112175-153112197 TGGTGGAAGCTCATGCCCAGGGG + Exonic
916738393 1:167628262-167628284 GGGCGGAAGTGCTTACCCAGAGG - Intergenic
917205426 1:172566032-172566054 AGTGGGAGGGGCTTGCACAGGGG + Intronic
918123221 1:181557769-181557791 AGGGGGCAGAGCTGGCTCAGCGG + Intronic
921029909 1:211327514-211327536 AGGTGGAAGGAGTTGCCCAGAGG + Intronic
924633888 1:245766894-245766916 ATGAGGAAGCGCTTGTCCAGGGG + Intronic
1067476508 10:46570908-46570930 GGAGGGAAGGGCTTTCCCAGAGG + Intergenic
1067618230 10:47770873-47770895 GGAGGGAAGGGCTTTCCCAGAGG - Intergenic
1069828232 10:71267243-71267265 AGAGGGAAGTGGCTGCCCAGGGG + Intronic
1070655399 10:78267664-78267686 AGGAGGGAGCCCTGGCCCAGGGG + Intergenic
1072635817 10:97177150-97177172 AGGTTGAAGCGCTTCCCCTGAGG + Intronic
1072637571 10:97187524-97187546 AGGGGGCAGGGCTTTCTCAGGGG + Intronic
1073321982 10:102621104-102621126 AGAAGGCAGGGCTTGCCCAGAGG - Intronic
1074102974 10:110368145-110368167 AGGGGACAGCGCCTGCCCTGTGG - Intergenic
1075834513 10:125442365-125442387 AGGGGAAAGTGCTTGAGCAGAGG - Intergenic
1075997922 10:126893212-126893234 AGGGGGTAGCCCTGCCCCAGTGG + Intergenic
1076302794 10:129440749-129440771 AGGGGGAAGCCCTTGCCATTCGG + Intergenic
1076505659 10:130971166-130971188 AGGGGGAGGCACATGCTCAGTGG - Intergenic
1076584027 10:131533155-131533177 ATGGGGAAGCGCCTGTGCAGAGG - Intergenic
1077101527 11:824633-824655 TGGGGGACGCGCTGGCCAAGTGG + Exonic
1079283253 11:19106775-19106797 AGGGAGAGGCACTTCCCCAGTGG + Intergenic
1079882316 11:25943780-25943802 GGGAGGAAGCGCGTGCCCACTGG + Intergenic
1080002276 11:27363228-27363250 GCGGGGACGCGCTTTCCCAGCGG + Exonic
1083895327 11:65616972-65616994 TGGAGGAAGAGCCTGCCCAGGGG + Exonic
1084540341 11:69782426-69782448 AGGTGGAATCCCATGCCCAGTGG - Intergenic
1084901597 11:72314195-72314217 AGGTGGCAGAGCTTCCCCAGGGG + Intronic
1084951434 11:72668297-72668319 AGGGGAAATCGCTTGCCCACAGG - Intronic
1089606573 11:119644866-119644888 AGGGGGCAGAGCATGCTCAGAGG + Intronic
1089688557 11:120172086-120172108 GGGGGCAAGTGCTTGCCCAAGGG - Intronic
1090832681 11:130429878-130429900 AAGAGGAGGCTCTTGCCCAGGGG + Intergenic
1092491503 12:8949675-8949697 TGGGAGGAGCGGTTGCCCAGCGG - Exonic
1095966714 12:47872658-47872680 AGAGGGAAGGGCTGGGCCAGGGG - Intronic
1096513579 12:52144868-52144890 CTGGGGAAGCCCTGGCCCAGAGG + Intergenic
1100790922 12:98128938-98128960 AGGAGGAGGGGCTGGCCCAGAGG + Intergenic
1101606170 12:106248467-106248489 AGGGGGTCGCGCTTGGCCCGCGG - Intronic
1102009960 12:109612129-109612151 AGGGAGAAGTGCTTGCTCTGAGG - Intergenic
1102047710 12:109840202-109840224 AGTGGGAAGCGGTTGCTTAGTGG - Intergenic
1104159120 12:126161679-126161701 AGGGGCAAGCCCCTTCCCAGTGG - Intergenic
1104970394 12:132528241-132528263 AGGGGGACGGGCTGGCCCTGTGG + Intronic
1105048558 12:133027661-133027683 AGGAGGAAGTGCTTGCCGATTGG - Intergenic
1105780805 13:23703878-23703900 AGGGAGAAGCGGATGCCCAGAGG + Intergenic
1105893441 13:24698682-24698704 ATGAGGAAGCGCTTGCCGTGGGG - Exonic
1108003714 13:45927205-45927227 AGGGGGATCTTCTTGCCCAGTGG + Intergenic
1110378439 13:74821129-74821151 AGCGGGAAGAGCTTGCTCAGAGG + Intergenic
1112011991 13:95300889-95300911 AGGGGGAGTCTCTTGCCCAGCGG - Intronic
1114297154 14:21340255-21340277 AGGGAGAAGAGCTTGCTCAAGGG + Intronic
1119217406 14:72879657-72879679 AGAGGAAACCGCCTGCCCAGAGG + Intronic
1119583097 14:75805403-75805425 AGGGAGAAGCAGATGCCCAGGGG - Intronic
1119864414 14:77961292-77961314 AGGGAGAACCGCATACCCAGAGG - Intergenic
1122413237 14:101536546-101536568 AGGGGGCACCCCATGCCCAGAGG + Intergenic
1122413926 14:101539555-101539577 AGGGGGAAGGGCTTACACAGGGG - Intergenic
1122634137 14:103122435-103122457 GGAGGGAAGCCCCTGCCCAGCGG + Intergenic
1126766604 15:52016949-52016971 CGGGGGAATCGCTTGAGCAGAGG + Intronic
1128447502 15:67776907-67776929 AGGGGGCAGCCCTTGACCAATGG + Intronic
1128777083 15:70328850-70328872 AGGGGGAAAAGAGTGCCCAGGGG + Intergenic
1129265032 15:74388832-74388854 TGGGGGAAGGGCTTGGCCACAGG - Intergenic
1133040685 16:3058617-3058639 AGGGGGGCGCGCCTTCCCAGAGG - Exonic
1133128494 16:3662252-3662274 AGGGAGCAGCGCTGGTCCAGGGG - Exonic
1133303687 16:4797534-4797556 AGGGGGATGGGGTAGCCCAGGGG + Intronic
1134242828 16:12518429-12518451 TGGGGGAAGGGCATGCCAAGTGG - Intronic
1134648270 16:15888356-15888378 ATGGGGAAGAGGTTGCCCACTGG - Intronic
1139432653 16:66919362-66919384 AGGGGGAGGGGCATTCCCAGAGG - Intergenic
1141643095 16:85352862-85352884 AGTGGGAAGAGCTAGGCCAGGGG + Intergenic
1142129559 16:88426529-88426551 AGCAGGAGCCGCTTGCCCAGAGG - Intergenic
1144707697 17:17380437-17380459 AGGGGGAAGGGCTGGGCCTGAGG - Intergenic
1149544519 17:57493495-57493517 ATGGGGTAGTCCTTGCCCAGTGG + Intronic
1150135695 17:62693762-62693784 AGAGGGAGGCGCAGGCCCAGAGG - Intergenic
1150358054 17:64505484-64505506 AGGGGGAAGCGCCGCCCCAGCGG - Intronic
1150508839 17:65727009-65727031 AGGGGGAACTGCTGGCCCAAAGG + Intronic
1152045412 17:77931746-77931768 AGGTGGAAGTGTTTGGCCAGAGG - Intergenic
1152084234 17:78207840-78207862 TTGGGGAAGCCCTTACCCAGGGG - Intergenic
1152237528 17:79146348-79146370 AGGAGGGAGAGCTTCCCCAGGGG + Intronic
1157607871 18:48937573-48937595 AGGGGGAAGTGCATGACCTGGGG + Intronic
1160681626 19:414066-414088 AGGAGGAGGCGCTGGACCAGAGG - Intergenic
1164707844 19:30333480-30333502 AGGAGGAATCTCTTGACCAGCGG - Intronic
1166158378 19:40932878-40932900 TGGGGAAAGCACTTGTCCAGTGG + Intergenic
1166988226 19:46675003-46675025 AGGGGGCAGGGCTGGCCCATTGG - Intronic
1167779710 19:51591081-51591103 GGGAGGAAGGGCTTGCCCTGAGG - Exonic
1168236095 19:55063901-55063923 AAGGGGAAGCAGGTGCCCAGAGG - Intronic
1168407895 19:56120479-56120501 GGGAGGAAGCGCGTCCCCAGCGG - Intronic
925342355 2:3146351-3146373 AGGAAGAAGCGCTTGGCCACAGG - Intergenic
925844111 2:8020378-8020400 AGAGGGAAGACCCTGCCCAGAGG + Intergenic
927238706 2:20901361-20901383 AGGGGCACCCTCTTGCCCAGAGG + Intergenic
928306596 2:30174937-30174959 AGGGGGATGCACTTTCCCAAGGG + Intergenic
928666451 2:33554848-33554870 ACGAGGGAGCGTTTGCCCAGGGG - Intronic
933002087 2:76937659-76937681 CAGGGGAATCGCTTGCCCACGGG - Intronic
934745119 2:96754373-96754395 AGTGGGAAGCACTTGGCCAGTGG - Intergenic
941950362 2:171149555-171149577 AGGGGGAAGAGCTTGCAAAGGGG + Intronic
946547070 2:220755847-220755869 ATGGGGAAGCACTTGCCAACAGG + Intergenic
946964084 2:225018280-225018302 AGGGAGAAACGCTAACCCAGGGG + Intronic
947624545 2:231611606-231611628 AGGGGGAAGCAGCTGCCCTGGGG + Intergenic
948198848 2:236115007-236115029 GGGGGGATGCTCTTGGCCAGAGG - Intronic
948468322 2:238162656-238162678 AGTGGCAAGAGCTTGCACAGGGG + Intronic
1172094802 20:32455452-32455474 AGGGAGAAGAGCCTGTCCAGAGG + Intronic
1172619505 20:36309659-36309681 AGGGGGAAATGCCTGGCCAGGGG - Intronic
1172644987 20:36463386-36463408 AGGGAGAGGAGCTTGCCCAAGGG + Intronic
1172809114 20:37634373-37634395 CGGAGGAAGAGCTTGGCCAGGGG - Intergenic
1175227162 20:57451318-57451340 AGGGGGAGGTGGATGCCCAGAGG - Intergenic
1178606002 21:34036857-34036879 AGGGGGAAGGTTTTACCCAGGGG + Intergenic
1178606019 21:34036911-34036933 AGGGGGAAGGTTTTACCCAGGGG + Intergenic
1180003559 21:45007594-45007616 AGGGGGATGGGGTTGCACAGAGG - Intergenic
1180953302 22:19730382-19730404 AGCGGGAAGGGCGTGCCCCGTGG - Intergenic
1183684717 22:39355116-39355138 AGTGGGAAGCACTGTCCCAGAGG + Intronic
1183856450 22:40637939-40637961 AGGGGGAAGCGCTTTCCGGAAGG + Intergenic
1185068451 22:48643552-48643574 AGGGACAACAGCTTGCCCAGGGG + Intronic
950450284 3:13061466-13061488 AGGGGGATGTGCCAGCCCAGTGG + Intronic
955072308 3:55582035-55582057 AGGGGGAACAGCTTGTACAGAGG - Intronic
959390739 3:105770359-105770381 AGGGTGAAGGGCTTCTCCAGTGG - Intronic
965042732 3:163531858-163531880 AGCAGGAAGCACTTCCCCAGGGG - Intergenic
967922286 3:194622439-194622461 AGGGGCGAGCGCTTGCCCTCCGG - Intronic
969516719 4:7652236-7652258 AGGGGGAGGCCCTTTCCCACGGG + Intronic
971157933 4:24103206-24103228 AGGGGGAAGCCTTGGCCGAGTGG + Intergenic
975413100 4:74077969-74077991 AGGAGGAAGAACTTCCCCAGGGG + Intergenic
977558564 4:98509299-98509321 ACAGTGAAGCCCTTGCCCAGTGG - Intronic
981858212 4:149321304-149321326 TGAGGGAAGATCTTGCCCAGGGG - Intergenic
981930847 4:150187890-150187912 AGGGGGAATCGCTTGAACCGGGG - Intronic
991569036 5:68035272-68035294 AAGGGGAAGAGATTGCCCAAGGG - Intergenic
992288984 5:75265441-75265463 AGGGGGAATCGCTTGAACACAGG - Intergenic
994733243 5:103519753-103519775 AGGGAGAAGCAATTGACCAGTGG - Intergenic
998252942 5:140564717-140564739 AGGGGGAGGTGCTTTCCTAGTGG - Intronic
1001058865 5:168471284-168471306 AGGAGGAAGCCCTGGGCCAGTGG - Intronic
1001404314 5:171465001-171465023 AGGGGGAATCGCTTGAACCGGGG - Intergenic
1002171185 5:177375397-177375419 AGGGAGAAGAGCATGCACAGAGG + Intergenic
1005922651 6:30415784-30415806 AGGGGGCAGCCCTAGCCCTGAGG - Intergenic
1006072302 6:31506698-31506720 AGGGGGCAGCCCTGGCCCTGAGG - Intronic
1007816486 6:44528852-44528874 TGTGGGATGTGCTTGCCCAGGGG - Intergenic
1011369056 6:86612724-86612746 TGGGAGATGGGCTTGCCCAGAGG - Intergenic
1011723547 6:90184654-90184676 AGGGGTAAGCCCTAGCCCAGGGG + Intronic
1012554437 6:100494482-100494504 AAGGGGAAGGGATTGCCCACAGG + Intergenic
1017529094 6:155269956-155269978 AGAGAGAAGTGCTTGCCCTGTGG + Intronic
1019934673 7:4246556-4246578 AGGGGGAAACGAATGTCCAGGGG - Intronic
1020122409 7:5512519-5512541 AAGGGGAATCGCTTGAGCAGGGG + Intronic
1021838145 7:24700947-24700969 AGGGGGAAACGGTGACCCAGAGG + Intronic
1022181102 7:27921300-27921322 AGGGGGAAGGGGAAGCCCAGAGG - Intronic
1023575756 7:41624844-41624866 TTGAGGAAGCACTTGCCCAGTGG + Intergenic
1029324121 7:99791031-99791053 AATGAGAAGGGCTTGCCCAGGGG + Intergenic
1032885515 7:136134047-136134069 AGGGAAAAGCCCTTGGCCAGGGG - Intergenic
1033120655 7:138664483-138664505 AGGGTCAGGGGCTTGCCCAGTGG - Intronic
1035690299 8:1555458-1555480 GGGGGGAAGCGGTGGCCCAGAGG - Intronic
1037577011 8:20215997-20216019 AGGGGAGAGCGCTTACCTAGGGG + Intronic
1038210034 8:25509046-25509068 AGGGGGAAATGGGTGCCCAGCGG - Intergenic
1039412874 8:37370130-37370152 TGAGTGAAGCGCTTGCCAAGAGG + Intergenic
1044628929 8:94260776-94260798 AGGGGGAAGCCCATGGGCAGTGG - Intronic
1046292700 8:112183599-112183621 AGAGGTAAGAGCATGCCCAGTGG + Intergenic
1047502764 8:125454670-125454692 AGGGGGAAGAGCATGGCCAGAGG + Intergenic
1050176827 9:2876951-2876973 GGAGGGCAGGGCTTGCCCAGAGG + Intergenic
1052366628 9:27619242-27619264 AGGGGGAACCCATTGCCCACAGG - Intergenic
1053387112 9:37701570-37701592 AGAGGGAAGAGCTTGTCCAAAGG + Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056834639 9:89944623-89944645 AGGAGGAAGGGCATGCACAGAGG + Intergenic
1056896826 9:90559110-90559132 AGGGGGCTGCCCTTGCCCACAGG + Intergenic
1057869880 9:98709242-98709264 AGGGGGAGGCGCTGGCGCTGCGG + Intergenic
1060486521 9:124051050-124051072 AGTGGGAAGTGCTTACCCTGGGG - Intergenic
1060730008 9:126031156-126031178 AGAGGGTAGGGCTTGCCCAGGGG - Intergenic
1060941753 9:127546519-127546541 TGGGGGAAGGGCTTGACCACAGG - Intronic
1061247177 9:129406465-129406487 AGCGGGAATGGCGTGCCCAGCGG - Intergenic
1061575344 9:131502867-131502889 AGGGTGACGCGCGTGCGCAGCGG - Intergenic
1061875410 9:133541091-133541113 GAGGGGAAGAACTTGCCCAGTGG - Intronic
1062275768 9:135729882-135729904 AGGGGGAAGTACCTGCCCAGTGG - Intronic
1062454418 9:136628974-136628996 AGGGGGAGGCGCTCGCCCACAGG - Intergenic
1185755664 X:2651145-2651167 AAGGGTAAGAGCGTGCCCAGTGG - Intergenic
1187083472 X:16016338-16016360 AGGGGGTAGTGCTTGCTCTGTGG - Intergenic
1187341471 X:18425429-18425451 AGGAGGAAGCGCTTGTCCTGGGG - Intergenic
1190363008 X:49666817-49666839 AGGTGGTAGTGCTTCCCCAGGGG + Intergenic
1190526255 X:51332463-51332485 AGTGCGAAGCGCCTGCGCAGTGG + Intronic
1190743500 X:53306319-53306341 AGGTGGAGGGGCTGGCCCAGGGG + Intronic
1191797341 X:65035011-65035033 GGGGGAAGGCGCTCGCCCAGCGG - Intergenic
1194111031 X:89835156-89835178 AGGGGGAAGCTCTTAGTCAGTGG + Intergenic
1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG + Intronic
1198249912 X:134870157-134870179 AGGAGGAAGAGCTTGCCCAAAGG + Intergenic
1199712169 X:150477169-150477191 AGGGTAAATCGCTTGCCCCGCGG - Intronic
1201255601 Y:12105557-12105579 AATGGAATGCGCTTGCCCAGAGG - Intergenic