ID: 1197763532

View in Genome Browser
Species Human (GRCh38)
Location X:130044329-130044351
Sequence TCCAGCTGGGCAGAAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197763525_1197763532 16 Left 1197763525 X:130044290-130044312 CCTCTGTTGATTAATTGTCTTCA 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG 0: 1
1: 0
2: 0
3: 24
4: 261
1197763524_1197763532 17 Left 1197763524 X:130044289-130044311 CCCTCTGTTGATTAATTGTCTTC 0: 1
1: 0
2: 1
3: 146
4: 507
Right 1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG 0: 1
1: 0
2: 0
3: 24
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197763532 Original CRISPR TCCAGCTGGGCAGAAAATGA AGG Intronic
900673040 1:3867871-3867893 CCAAGCAGGGCAGAATATGAGGG - Intronic
903662385 1:24986075-24986097 TCCAGCTGGACAGACAAAGCAGG - Intergenic
903743520 1:25572082-25572104 TCCTGCTGGGCATCAAAGGAAGG + Intergenic
904375718 1:30081099-30081121 TCCGTCTGAGCAGAAACTGAGGG - Intergenic
904885860 1:33737919-33737941 TCCAGCTGGAAAAAAAAGGAGGG - Intronic
904938586 1:34149289-34149311 TCCAGCCAGGGAGAAAGTGAAGG + Intronic
905300883 1:36985547-36985569 TCCTGCTGGGCAAAAGATGTGGG + Intronic
907289505 1:53403673-53403695 CCAGACTGGGCAGAAAATGAAGG - Intergenic
909043314 1:70679568-70679590 TTCACCTGGGCACAAATTGAAGG + Intergenic
909441809 1:75704334-75704356 TAAAGCTCGGCAGAACATGATGG + Intergenic
912579360 1:110706148-110706170 TCCATGTTGGCAGAAAATGGTGG + Intergenic
913404939 1:118479942-118479964 TCCTGCATGGCAGAAAATCATGG + Intergenic
914801070 1:150962989-150963011 TCCAGCAGCACAGAAAGTGAGGG + Exonic
914808004 1:151005820-151005842 TCCAGCTGGAGAGAAAGTGTAGG - Intronic
914913779 1:151805902-151805924 TCCACCTGGGGAGAAACTGCAGG + Exonic
917519344 1:175735172-175735194 TCCAGCTGGGCAGACAGACAGGG - Intronic
918121814 1:181547034-181547056 TGAAGCTGGGGAGAAAATGACGG - Intronic
921247683 1:213262182-213262204 GCCTCCTGGGAAGAAAATGAAGG + Intronic
923053144 1:230403001-230403023 GGCAGCTGGGAAGAAAATGATGG - Intronic
1064104288 10:12488339-12488361 TTCTGCAGGGCACAAAATGAGGG + Intronic
1064252449 10:13717228-13717250 TACATCTGGGGAGAAAATGATGG + Intronic
1065547008 10:26831901-26831923 GGCAGCTTGGAAGAAAATGATGG - Intronic
1066567890 10:36739615-36739637 TCCAGCGGGACAGGATATGAAGG - Intergenic
1067396951 10:45929395-45929417 TCTACTTGGGCAGAAACTGAAGG - Intergenic
1067494162 10:46747363-46747385 GCCTGCTGGGCTGAAAATCATGG - Intergenic
1067600497 10:47593034-47593056 GCCTGCTGGGCTGAAAATCATGG + Intergenic
1067865264 10:49898491-49898513 TCTACTTGGGCAGAAACTGAAGG - Intronic
1068234444 10:54215321-54215343 TTCTACTGGGCAGTAAATGAGGG + Intronic
1068237942 10:54262952-54262974 GCCAGCTGGGCTGAAAATCACGG + Intronic
1068652325 10:59536367-59536389 TCCAGCTGGACAGAAAGACAGGG - Intergenic
1070144091 10:73761043-73761065 TATAGCTGGGCAGAGAAGGAAGG + Intronic
1070205684 10:74258636-74258658 TTTAGCTGGGAAAAAAATGAAGG + Intronic
1071112459 10:82175730-82175752 TCATACTGGGCAGACAATGATGG - Intronic
1071652030 10:87400906-87400928 GCCTGCTGGGCTGAAAATCATGG + Intergenic
1074161122 10:110837162-110837184 TCCAGCTGGGCAGATAGTTGAGG + Exonic
1075077563 10:119361144-119361166 TCCTGCTGGACAGAAAACCAGGG - Intronic
1075171665 10:120121219-120121241 TCCAGATGTGCAGCAAATAAAGG + Intergenic
1075862772 10:125691457-125691479 TCAAGCTGGGCAGTGAATGTGGG + Intergenic
1077838283 11:5944598-5944620 TTCAGCTGTGGAGAAAATAAAGG - Intergenic
1077923231 11:6656279-6656301 AAGAGCTGGGGAGAAAATGATGG - Intergenic
1078645790 11:13140563-13140585 TCAGGCTGGGCAGGAAATGATGG - Intergenic
1079118679 11:17660052-17660074 TCCAGAAGGCCATAAAATGAAGG + Intergenic
1079783503 11:24640254-24640276 TCAAGCTGGGCGGAAAGTTAAGG + Intronic
1080572805 11:33571546-33571568 TCAAGCATGGCAGAAGATGAAGG + Intronic
1080943511 11:36945659-36945681 TTCTGCTGAGCAGAAAATGGAGG - Intergenic
1081483149 11:43507301-43507323 TGGGGCTGGGCAGAAGATGAAGG + Intergenic
1083084934 11:60133282-60133304 ACAATCTGGGCAGAAGATGAAGG - Intergenic
1083250447 11:61463493-61463515 ACCATCAGGGCAGAAAGTGAAGG + Intronic
1084248928 11:67880731-67880753 GCCAGCTGGGCAGAACATCCAGG - Intergenic
1085846201 11:80068501-80068523 TCCAGGTGGAAAGAAAATGGTGG + Intergenic
1086485448 11:87295488-87295510 TCCATCTGGACTTAAAATGAAGG - Intronic
1086508441 11:87529431-87529453 TCCAGCATGGGAGAAAATGAAGG - Intergenic
1089014724 11:115156663-115156685 TGCTGCTGGTCAGCAAATGAAGG - Intergenic
1089723462 11:120451494-120451516 GCCAACTGATCAGAAAATGATGG - Exonic
1090461063 11:126892002-126892024 TCCAGCTGGGCATGGAAGGAAGG - Intronic
1093832521 12:23780916-23780938 AGGAGCTGGGCAGAAAGTGAAGG + Intronic
1095386440 12:41656068-41656090 TCTAGAAAGGCAGAAAATGAAGG + Intergenic
1096121227 12:49090604-49090626 CCAACCTGGGCAGAAAAGGAAGG + Intronic
1097131772 12:56816520-56816542 TCCTCCTAGGAAGAAAATGAAGG - Intergenic
1097279450 12:57835583-57835605 TGCATCTGGGCAGAAGAGGAGGG - Intronic
1097757660 12:63425184-63425206 TCAAGCTGGGGAGAGAATCAGGG + Intergenic
1097813555 12:64045836-64045858 TCCAGCAGTGAATAAAATGAAGG + Intronic
1098022463 12:66170095-66170117 TCCAGCTGGGCGGAGAAAGCGGG + Intergenic
1098594684 12:72258007-72258029 GACAGCTGGGTAGAAGATGAGGG + Intronic
1098595705 12:72272054-72272076 TGCAGCTGGAGAGAAAAGGATGG - Intronic
1100137244 12:91568452-91568474 TTCAGCTGGTCAGGAGATGAAGG + Intergenic
1100964999 12:100003217-100003239 TCCAGCTTGGGAGAAAATATGGG - Intergenic
1104769137 12:131349830-131349852 TGCAGTTGAGCAGAAGATGATGG - Intergenic
1105274425 13:18906330-18906352 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1105349292 13:19601705-19601727 GCCAGCTGGGCTGAGGATGAGGG - Intergenic
1106041123 13:26094893-26094915 TCCAGCTGGACTGAATATGTTGG + Intergenic
1108018374 13:46099235-46099257 TCCAGCTGGGCAGAAATATGGGG + Intronic
1110828854 13:80006716-80006738 TCCAGTTGGGTGGAAAATGATGG - Intergenic
1111454415 13:88461687-88461709 TCAAGCTGAGCAGAAAATTACGG + Intergenic
1114051345 14:18921406-18921428 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1114111217 14:19480519-19480541 TGCAGCTGGCCAGAAATTGCTGG + Intergenic
1114129470 14:19773466-19773488 TACATCAGGGCAGAAACTGATGG + Intronic
1114713238 14:24799614-24799636 TTCAGCCTGGCAGAAAATCAGGG + Intergenic
1114717157 14:24839017-24839039 TCCAACAGGCCATAAAATGAAGG + Intronic
1116646826 14:47539438-47539460 TACAGCGGAGCAGATAATGAAGG + Intronic
1117541361 14:56749690-56749712 TCCTGCTGGGAAGAACATGATGG - Intergenic
1119430914 14:74567512-74567534 GCAAGCTAGGGAGAAAATGAGGG - Intronic
1119901537 14:78264547-78264569 GCCAGCAGGGCAGAAACTGATGG + Intronic
1120676810 14:87430230-87430252 TCCAGCACAGAAGAAAATGACGG - Intergenic
1122331335 14:100917028-100917050 TCCTGCTGGGCAGATGATGTGGG + Intergenic
1122384472 14:101334503-101334525 CAAAGCGGGGCAGAAAATGATGG + Intergenic
1124422100 15:29531471-29531493 TGAAACTGGGCAGAACATGAAGG + Intronic
1124608695 15:31192988-31193010 TCCAGCCATGCAGAAAAGGAAGG - Intergenic
1127035862 15:54916956-54916978 AGAAGCTGGGCAGAAAAGGAGGG + Intergenic
1128716022 15:69908627-69908649 TCCAGGTGAGCAGTAAATGGTGG - Intergenic
1131543118 15:93291144-93291166 TCCATTTGGGCTAAAAATGAAGG + Intergenic
1133113136 16:3561617-3561639 GCCAGCTGAGCAGAGGATGATGG + Intronic
1133703591 16:8332411-8332433 TGCAGCAGAGCAGAAACTGATGG + Intergenic
1134197789 16:12172255-12172277 TCAAGATGGGAAGAAAAAGAAGG + Intronic
1136066894 16:27765415-27765437 GCCAGCTGGGAAGAGCATGAGGG + Intronic
1136270529 16:29145821-29145843 TCCAGCTGGGCCCAACATAATGG + Intergenic
1137601708 16:49760685-49760707 TCGAACTGAGCAGAGAATGAGGG + Intronic
1137750591 16:50858557-50858579 CCCAGCTGGGCAGGAAAGGGAGG - Intergenic
1139118570 16:63987146-63987168 TCCAGCAGGTGAGAAAAGGAAGG - Intergenic
1139303836 16:65966799-65966821 TCAAGCTGGGGAGAACAAGAGGG - Intergenic
1139690866 16:68641288-68641310 CACAGAAGGGCAGAAAATGATGG - Intronic
1140719238 16:77756081-77756103 TCAATGTGGGCAGAGAATGAAGG - Intergenic
1142074115 16:88107632-88107654 TCCAGCTGGGCCCAACATAATGG + Intronic
1143387457 17:6540161-6540183 TACAGGTGAGCAGAAAAGGAAGG + Intronic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1147645951 17:42034006-42034028 TACAGCTGGGCAGAAGGGGAAGG + Intronic
1149026178 17:52030112-52030134 TCCAGCTGAGCAGTAAATCCTGG + Intronic
1150198038 17:63321648-63321670 TGGAGCTGGGCAGGAAAAGAGGG + Intronic
1152142531 17:78545462-78545484 TCCTGGTGGGCAGATGATGATGG + Intronic
1154466114 18:14643585-14643607 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1157781038 18:50439404-50439426 TCCACCTGGGCTGGGAATGAGGG - Intergenic
1158468866 18:57716461-57716483 TCCACCTGGACTGAAAATGAAGG + Intronic
1158522357 18:58182344-58182366 TTCAGTGGGACAGAAAATGAGGG + Intronic
1158816109 18:61099094-61099116 TCTACCTGGGAAGAAAATGCTGG - Intergenic
1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG + Intronic
1160937025 19:1601300-1601322 TCCAGCTAAGAAGGAAATGAGGG + Intronic
1161439535 19:4282852-4282874 TCCAGCTGCGGAGAGAAGGAAGG - Exonic
1164596979 19:29536692-29536714 TCCAGCTGGGCAGAGAGTGTGGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166312085 19:41968778-41968800 TCCAGCAGGGCATGAAGTGAGGG - Exonic
1166903010 19:46080899-46080921 TCCACCTGGACAGGAAGTGATGG - Intergenic
925115325 2:1373830-1373852 GCCAGCTGGGGAGAAAACTACGG - Intergenic
926266687 2:11329141-11329163 TGAAGATGGGCAAAAAATGAAGG - Intronic
927151402 2:20198500-20198522 TCCAGCTTGGCAGAAGAGAAAGG - Intergenic
928112149 2:28519409-28519431 TCCAGGTGAGGGGAAAATGAAGG + Intronic
928333804 2:30378209-30378231 CCCAGCTGGGAAGAAAAAAATGG - Intergenic
929085047 2:38159711-38159733 TCCAGGAAGGCTGAAAATGAAGG + Intergenic
929458544 2:42084415-42084437 TCCAGCTGGGCAGTGATTTATGG - Intergenic
930035282 2:47081208-47081230 TCCATCTGGGCAGAGAGAGAAGG - Intronic
932122969 2:69118504-69118526 TGCAACTGGGGAGAAAATTAGGG - Intronic
934927930 2:98394809-98394831 GCTATCTGGGCAGAAAAGGAAGG - Intronic
935039993 2:99416947-99416969 TCCAGCCAGGAAGCAAATGAAGG + Intronic
935569521 2:104644283-104644305 TCCTGCTAGGCAGCAAAAGAAGG + Intergenic
936880444 2:117244048-117244070 TCCACCTGGTCTCAAAATGATGG - Intergenic
936926154 2:117739042-117739064 TCAAGCTGGGCAGAATTGGAAGG - Intergenic
937390256 2:121479870-121479892 TCCAGCTTGGCTGGAAATGTTGG + Intronic
937823869 2:126343338-126343360 ACCAGCTGGGCTGTGAATGATGG - Intergenic
937992475 2:127672371-127672393 GCCAGCTGGGCAGGGAGTGAAGG - Intronic
938200537 2:129368907-129368929 TCCAGCTGGATGGAAAATAATGG - Intergenic
938312529 2:130302305-130302327 TCCTGCTGGACAGAAATTGCTGG - Intergenic
938575474 2:132599149-132599171 TCCTGCTGGGCAGATAATCCAGG + Intronic
938768876 2:134482925-134482947 GCCAGCCGGCCAGAAAATGCCGG - Intronic
940088226 2:149885896-149885918 TGGAGATGGGGAGAAAATGATGG - Intergenic
940500011 2:154482042-154482064 AGCATCTGTGCAGAAAATGAAGG - Intergenic
944218802 2:197281814-197281836 CACTGCTGGGAAGAAAATGAGGG - Intronic
946112928 2:217436180-217436202 GCCAGGTGGGAAGAAAATAAAGG + Intronic
946800684 2:223413162-223413184 TGCAGCTGAGGTGAAAATGAGGG + Intergenic
947993230 2:234503926-234503948 TCAAGCTGGGCAAACACTGATGG - Intergenic
1168937371 20:1677278-1677300 TCCATATGGCCAGAAAGTGAAGG - Intergenic
1170603467 20:17859234-17859256 TGCAGCTGGGGAGGAGATGAAGG + Intergenic
1170943971 20:20872957-20872979 TCCAGGTGGGCAAATAAAGAAGG + Intergenic
1172623715 20:36335740-36335762 TCCAGGTGGGCAAAAGATGAAGG - Intronic
1173344641 20:42187677-42187699 TCCAGCTGAGTAGATATTGATGG + Intronic
1174545326 20:51320806-51320828 TCCAGATGGAAATAAAATGAAGG + Intergenic
1176267856 20:64220128-64220150 CCCAGCTGCTCAGAAGATGAAGG - Intronic
1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG + Intergenic
1177458474 21:21376556-21376578 TTTAGCTGGGTAGAAAATAATGG + Intronic
1178392709 21:32212482-32212504 TCCAGGAGGGCTGAAACTGAAGG + Intergenic
1178702570 21:34845750-34845772 TGCAGCTGCTGAGAAAATGAAGG - Intronic
1180469818 22:15643781-15643803 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1180712793 22:17851083-17851105 TCCAGGTGGGCAGGTAATGAAGG - Intronic
1181525756 22:23485042-23485064 TTTTGCTGGGCAGAAAAAGACGG - Intergenic
1182929738 22:34161423-34161445 TCCTGCTGCGGAGAAAAGGATGG - Intergenic
1184029733 22:41885103-41885125 TCCAGGTGGGCAGCACCTGATGG - Intronic
1184180658 22:42822313-42822335 TCAAGCTGCGGATAAAATGAAGG - Exonic
1184316750 22:43699280-43699302 CCCAGCAGGGCAGGAACTGAGGG - Intronic
1184342875 22:43895708-43895730 TCTACCTGGGGAGAAAATGCCGG - Intergenic
950640995 3:14347987-14348009 TCGATCTGGGCTGAAAGTGAGGG + Intergenic
954982280 3:54757204-54757226 TCCAGCTGTGCAAATAAAGAAGG + Intronic
955685667 3:61546372-61546394 TCCACCTGGACTGAGAATGAAGG - Intergenic
955923971 3:63987882-63987904 TCTAGCTAGGGAGAAAATAATGG + Intronic
956143183 3:66166120-66166142 TCCACGTTGGCAGAAACTGAAGG - Intronic
956761499 3:72448091-72448113 TGGAGCAGGGCAGAAAGTGAAGG - Intergenic
956911003 3:73816892-73816914 TCCTGCTGGACAGGATATGAGGG + Intergenic
956912744 3:73836203-73836225 TCCAGATAGGCAAAAACTGAGGG + Intergenic
957299256 3:78369810-78369832 TCTAGATGGGCAGAAAAATATGG - Intergenic
958843159 3:99233114-99233136 TCCAGCTGTTCAGGAAAAGAGGG - Intergenic
959142595 3:102504629-102504651 TCAAGCTGGGCAGAAGAGTAGGG + Intergenic
960665295 3:120103156-120103178 GCCACTTGTGCAGAAAATGATGG + Intergenic
961151563 3:124642699-124642721 TCCAGATGGGGAAAAAATAATGG + Intronic
961570295 3:127792953-127792975 CACATCTGGGCAGAAACTGAAGG + Intronic
961796199 3:129410865-129410887 TCCAGCTGTGATGAAAATGCAGG + Intronic
963025414 3:140914039-140914061 TCTTGCTGGGAAGAAAAGGAAGG + Intergenic
965187647 3:165485701-165485723 TCCAGTTGGGGAGAGAGTGAAGG + Intergenic
965469321 3:169071229-169071251 TCCAGCTATGCAGAATAGGATGG - Intergenic
965630966 3:170732242-170732264 TTCAGATGGGCAGAAGATCATGG + Intronic
966138049 3:176723142-176723164 TCTAGCTAGGCAGAAAATGGTGG + Intergenic
969035381 4:4249195-4249217 TGCAGCTGCTCAGAAAATGTTGG - Intergenic
969247352 4:5944367-5944389 TCCTGGGGGGCAGAGAATGAAGG - Intronic
970265976 4:14286788-14286810 TGCAAATGGCCAGAAAATGAGGG + Intergenic
970733123 4:19132366-19132388 AGCAGCTGGGTTGAAAATGATGG - Intergenic
975048920 4:69834879-69834901 TCCATGTTGTCAGAAAATGAGGG - Intronic
976382413 4:84414942-84414964 TCAAGGTGGGAAAAAAATGATGG - Intergenic
977045907 4:92069279-92069301 ACAATCAGGGCAGAAAATGAAGG - Intergenic
977875400 4:102143635-102143657 GCCAGCTGAGCAGACGATGAGGG + Intergenic
978742135 4:112148449-112148471 TCCATTTGAGCAAAAAATGAAGG + Intronic
978786783 4:112618765-112618787 TGTAGCAGTGCAGAAAATGATGG - Exonic
978899917 4:113936064-113936086 TCCTAGTGGGCAGCAAATGAGGG - Intronic
979350177 4:119634982-119635004 TCCAGCGAGGAAGAAAATGAAGG + Intergenic
981215386 4:142159740-142159762 TCTAGTTGGGCCGAATATGATGG - Intronic
985113721 4:186571450-186571472 TGAAGCTGGTGAGAAAATGAGGG + Intergenic
985919682 5:2960463-2960485 GCCAGCTGGGCAGAAAACGTGGG + Intergenic
987246810 5:16057312-16057334 CCCAGTTGGGGAAAAAATGAGGG - Intergenic
988519296 5:31931513-31931535 TGCAGCTGGGCAGGAGTTGAGGG + Intronic
989095449 5:37777389-37777411 TCCAGCTGTGAAGGAAAAGATGG - Intergenic
991292587 5:65047006-65047028 TTAATCTGGGCAGAAGATGATGG - Intergenic
991590614 5:68247785-68247807 TCCCGTTGGGCAGGAAATAATGG - Intronic
993372951 5:87115120-87115142 TGAAGCTGGGCAGAAAATAAAGG + Intergenic
998989949 5:147804558-147804580 TGCAGCTGAGCAGGAAATGCAGG + Intergenic
999720862 5:154398412-154398434 TCCAGCTGGGGACAAAGAGAAGG - Intronic
1000020201 5:157311646-157311668 TCCACCTGGGTAGAAAATTATGG - Exonic
1000024336 5:157345881-157345903 GCCAACTGGGGAGAAAATGTAGG - Intronic
1000364798 5:160480798-160480820 TCAGCCTGGTCAGAAAATGATGG - Intergenic
1000519934 5:162282907-162282929 TACAGGTGGGGAGAATATGATGG - Intergenic
1001126231 5:169022069-169022091 TCCAGCTGGGGAAAACATCAGGG + Intronic
1001141117 5:169144787-169144809 GCAACCTGGGCAGAAAAAGACGG + Intronic
1002164826 5:177337667-177337689 TCCTGCTGAGCAGGAAAGGAAGG - Intronic
1004003681 6:11619850-11619872 TCCTGCAGGGCAGAAAATCATGG - Intergenic
1004340411 6:14803395-14803417 TCAAGGTGGGCAGATCATGAGGG - Intergenic
1004804125 6:19183525-19183547 GCCAACTGGGCAGGAAATTAAGG + Intergenic
1006433887 6:34015857-34015879 TCCAGCAGTGCAGAAAAGGGAGG - Intergenic
1010771386 6:79835556-79835578 TACAGTTAGACAGAAAATGAGGG + Intergenic
1011812852 6:91153155-91153177 TCGAGCATGGCAGAAAATCAGGG - Intergenic
1011855316 6:91682600-91682622 TAGAGCTGAGCAGAAAATCACGG - Intergenic
1014102328 6:117525358-117525380 ACCAGCTGGGCAGAATTTGCTGG - Exonic
1014102694 6:117529371-117529393 ACCAGCTGGGCAGAATTTGCTGG - Intronic
1015862940 6:137699452-137699474 TACAGCTGGGCAGGCAAGGAGGG + Intergenic
1019788220 7:2993161-2993183 TCCAGGTGGGCAGGAAATCTGGG + Intronic
1020896230 7:13943990-13944012 TCCAGATGGGTAGGAAATGGAGG + Intronic
1021531130 7:21646650-21646672 TCCAGCAGGGCAAGAAATAATGG + Intronic
1022148997 7:27579458-27579480 TCCAAAAGGGCAGAAAGTGAAGG + Intronic
1023647354 7:42331590-42331612 TCCTGCTTGGCAGAACCTGAAGG - Intergenic
1024005763 7:45224180-45224202 TCCAGCTTTGCATCAAATGAAGG + Intergenic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1027048743 7:75008191-75008213 TCCAGCTGACCAGCAGATGAGGG - Intronic
1027136141 7:75625352-75625374 TCTAGATGGGGAGAAAGTGATGG + Intronic
1028497058 7:91473593-91473615 TCCACATAGGCAGGAAATGAAGG + Intergenic
1029645279 7:101851341-101851363 CCCAGCTGGGCAGAATAGGGGGG - Intronic
1033599573 7:142879032-142879054 GACAGCTGGTCTGAAAATGATGG - Intronic
1035055938 7:156036695-156036717 TCCTGCTTAACAGAAAATGAAGG - Intergenic
1035063262 7:156085483-156085505 ACCAGCTGTGCAGAACCTGATGG - Intergenic
1036692949 8:10956295-10956317 TTCAGATGGGCAGAAAGTAAAGG - Intronic
1037887498 8:22602519-22602541 TCCCGCTGAGCAGAGGATGAGGG - Exonic
1038102467 8:24393843-24393865 TGCAGATGGGAAGAAGATGAGGG + Intronic
1040284724 8:46093924-46093946 TGCAGGTGGGCAGAAACTCAGGG + Intergenic
1040319499 8:46285526-46285548 TGCAGGTGGGCAGAAACTCAGGG - Intergenic
1040320238 8:46290745-46290767 TGCAGCTGGGAAGAAACTCAGGG - Intergenic
1041235627 8:55799199-55799221 TCCCGCCAGGCAGAAACTGAAGG + Exonic
1041705573 8:60843225-60843247 TCCAGCTTCACAGATAATGATGG - Intronic
1042217388 8:66439609-66439631 TGCAACTGGGCAGAGAAAGATGG + Intronic
1044430898 8:92104503-92104525 TCCAGCTGGGTTTAAAAGGATGG - Intergenic
1047090473 8:121568893-121568915 TCAAGCTGAGCAGACATTGATGG - Intergenic
1048404782 8:134108252-134108274 TCCAGCAGGGCAGAAATGGAAGG - Intergenic
1050165251 9:2758537-2758559 TCCAGCTGGGGATGAAATCATGG + Intronic
1050240904 9:3633644-3633666 ATCAGCTGGGCACAAAATGAAGG - Intergenic
1050489225 9:6170005-6170027 TTTAGCTGGGCACAAAATCAAGG - Intergenic
1051000048 9:12270548-12270570 TAAAGCTGGGGAGAAAAGGAAGG - Intergenic
1052203613 9:25811474-25811496 CCCAGCAGGACAGAAGATGAAGG - Intergenic
1053847008 9:42249728-42249750 TACAGCATGGGAGAAAATGAAGG - Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1058317355 9:103585764-103585786 ACCAACTGGGCAAAAAAGGATGG + Intergenic
1059735933 9:117099652-117099674 TTCAGTTGGTGAGAAAATGAAGG + Intronic
1059850553 9:118333758-118333780 TCCAGAAGGGCAGAAGAGGATGG + Intergenic
1060733682 9:126052989-126053011 TCCAGCTGGGCAGTCCCTGAAGG + Intergenic
1061328016 9:129875684-129875706 CCCAGCTGGGCAGGAAAAGAGGG + Intronic
1061875298 9:133540547-133540569 TTCAGCGGGGCAGGAAATGCCGG - Intronic
1062163582 9:135093700-135093722 TCCTGCAGGCAAGAAAATGAAGG + Intronic
1062183710 9:135205063-135205085 TCCTCCTGGGCAGAACATCAAGG + Intergenic
1185513213 X:678303-678325 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185513254 X:678500-678522 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185513294 X:678697-678719 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185513335 X:678894-678916 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185690442 X:2150766-2150788 TCCATCTGTGCAGCAAAGGAAGG - Intergenic
1188310220 X:28607881-28607903 TCCATCTGTACAGAAACTGAGGG + Intronic
1189795864 X:44645431-44645453 TCCAGGTGGGCTGAGAAAGAAGG + Intergenic
1193634009 X:83925856-83925878 TTCAGTTAGGCAGAAAATAAGGG + Intergenic
1193833273 X:86312678-86312700 TCCAGCAAGGGAGAAAATGTAGG - Intronic
1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG + Intronic
1199980164 X:152916449-152916471 TCCTGCTTGGCAGCAACTGAGGG - Intronic
1201304968 Y:12542269-12542291 TCCACCTGGGCATCAAATGGTGG - Intergenic
1201453831 Y:14146468-14146490 AACAGTTGGGCAGAAAATAATGG - Intergenic
1202029624 Y:20558075-20558097 TCCAGTAGGGCAGAAAACCAAGG - Intergenic