ID: 1197765570

View in Genome Browser
Species Human (GRCh38)
Location X:130057441-130057463
Sequence ACAATGCCACAGAGGGGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197765570 Original CRISPR ACAATGCCACAGAGGGGGCG GGG (reversed) Exonic
900570213 1:3354574-3354596 ACAAGGTCACAGAGGGGCCATGG + Intronic
901254871 1:7814776-7814798 ACAATACTACAGAGGGTGGGAGG + Intronic
901337120 1:8460033-8460055 ACAATGACAAAGAGGGAGAGAGG - Intronic
902087412 1:13874174-13874196 AGAATGCCACAGACAGGGTGGGG + Intergenic
902792628 1:18779263-18779285 AAAATGCCACAGTGTGGGCATGG + Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903442019 1:23395310-23395332 CCAAGGCCACAGAGGGGACGAGG + Intronic
907213256 1:52841143-52841165 ACAATGCCACAATGTGGGAGTGG - Intergenic
907988991 1:59560881-59560903 ACAGTGTCTCAGTGGGGGCGGGG - Intronic
914867537 1:151444190-151444212 CCAAAGCCACAAAGGGGGTGAGG + Intronic
916694447 1:167221475-167221497 ACAATGCCGGGGAGGCGGCGGGG + Intronic
919750649 1:201035698-201035720 AAAATGACACAGAGAGGGCCAGG - Intergenic
920571579 1:207022034-207022056 ACACTGACACAGGGGGGGCGAGG + Exonic
1065853617 10:29812390-29812412 ATGATGCCACAGAGGTGGGGAGG + Intergenic
1069312419 10:67054656-67054678 ACAATGTCACAAAGTGGGAGAGG + Intronic
1074615040 10:115059272-115059294 ACAAAGCCAGAGAGGTGGTGTGG + Intergenic
1075745422 10:124724208-124724230 TCAATGCCAGAGATGGGGTGAGG + Intronic
1075832087 10:125419995-125420017 ACAAGGACACAGAGGGCGTGGGG + Intergenic
1077001782 11:326971-326993 AAAATGCCACAGAGGTCGAGGGG + Intronic
1077252974 11:1568766-1568788 AGAAGGCCTCTGAGGGGGCGGGG - Intronic
1078427366 11:11262656-11262678 AGAATGCCACAGAGAAGGGGTGG - Intergenic
1078706458 11:13748394-13748416 ACAATGTCAAAGAGGAGGAGTGG - Intergenic
1079312131 11:19376445-19376467 ACGAGGGCACAGAGGGGACGAGG + Intronic
1079534868 11:21501866-21501888 AAAATGCCAGAGAAGGGGCAAGG - Intronic
1080588392 11:33700721-33700743 ACGATGCCAAAGGGGCGGCGCGG - Exonic
1081781447 11:45715936-45715958 ATAAAGCCACACAGGAGGCGTGG + Intergenic
1082666497 11:55982002-55982024 ACAATATCACAGAGTGGGGGCGG - Intergenic
1083736005 11:64681860-64681882 ACCATGCCAGAGAGGGAGAGAGG + Intronic
1084261243 11:67980166-67980188 ATAAGGTCACAAAGGGGGCGGGG - Intergenic
1086109817 11:83187657-83187679 ACAATAGCACAGGAGGGGCGGGG + Intergenic
1088199156 11:107311433-107311455 ACCATGCCACAGAAGGGGAAAGG + Intergenic
1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG + Intergenic
1091746232 12:2994873-2994895 ACAATGACGCAGAGGGCGTGTGG + Exonic
1094537721 12:31336772-31336794 AAAATCCCAAAGAGGGGGCCGGG - Intergenic
1094644839 12:32312372-32312394 ACAATTCTACAGAGGAGGCATGG - Intronic
1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG + Exonic
1096478346 12:51922338-51922360 ACTATGCCACAGAGAGGGCGAGG - Intronic
1100568867 12:95826595-95826617 ACAATTCAAAAGAGGGGGTGAGG + Intergenic
1102679206 12:114679210-114679232 ACAAAGCCCAAGAGGGGGGGAGG + Intronic
1107727220 13:43311038-43311060 AGAATTCCACAGAGGGGAGGGGG + Intronic
1108363752 13:49690881-49690903 TAAATGCCCCAGAGGGGGCAAGG - Intronic
1109537731 13:63739984-63740006 ATGATGTCACAAAGGGGGCGGGG - Intergenic
1109546578 13:63841759-63841781 ATGATGTCACAAAGGGGGCGAGG + Intergenic
1112119919 13:96398572-96398594 AAAATGCAACAGATGGGGCTGGG - Intronic
1112242272 13:97694117-97694139 AGAAGTCCAGAGAGGGGGCGTGG + Intergenic
1112484931 13:99811385-99811407 ACAATGCCACAGAGCTGGCGTGG + Intronic
1113274033 13:108708044-108708066 ACAATTTCACAGAGGGTGAGGGG + Intronic
1115391562 14:32860479-32860501 ACAGAGCCACAGAGGGAGCCAGG - Intergenic
1115498923 14:34032340-34032362 TCAATGCCAAAAAGGGGGTGTGG - Intronic
1120583668 14:86285316-86285338 TCAATGCAACAGAGTGGGCAGGG - Intergenic
1121507371 14:94487070-94487092 AGAATGCCACCAAGTGGGCGGGG + Intergenic
1122125428 14:99576130-99576152 ACAATCCCACAAAGAGGGCCAGG + Intronic
1122464146 14:101918656-101918678 ACAGTGCCCGGGAGGGGGCGAGG - Intronic
1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG + Intronic
1122894604 14:104750321-104750343 ACACTGCCTCTGAGGGGGCGTGG + Intergenic
1123431294 15:20219285-20219307 ACACTGCCACAGAGCTGGGGAGG + Intergenic
1123695104 15:22873446-22873468 ACAAAGCCCCAGAGGAGGGGAGG - Intronic
1123698912 15:22900313-22900335 CCAGTGTCTCAGAGGGGGCGTGG + Intronic
1124581088 15:30955637-30955659 ACACTGCCAAGGGGGGGGCGGGG + Intronic
1125854540 15:42936366-42936388 ACAGTGCCACAGGCTGGGCGAGG - Intergenic
1127477455 15:59348129-59348151 TCAATGCCACAGTGGGGAGGAGG + Intronic
1132653112 16:1030528-1030550 ACACTGACACGGCGGGGGCGGGG - Intergenic
1133258632 16:4534244-4534266 AGAATGGCACAGAAGGGGCTGGG - Intronic
1134704475 16:16292872-16292894 ACAATGAGACAGAAGGGGCCTGG - Intronic
1134803205 16:17104414-17104436 ACCATTCCACAGAGGGGGGATGG - Exonic
1134963067 16:18419242-18419264 ACAATGAGACAGAAGGGGCCTGG + Intronic
1134967362 16:18501841-18501863 ACAATGAGACAGAAGGGGCCTGG + Intronic
1135955881 16:26955831-26955853 GCAGTGCCTCAGAGGGGGTGGGG + Intergenic
1136627283 16:31469568-31469590 ACAGTGCAAGAGAGGGGGTGGGG - Intergenic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1138659872 16:58510610-58510632 ACAGAGCCGGAGAGGGGGCGGGG - Intronic
1139139173 16:64240243-64240265 AGCATGAGACAGAGGGGGCGAGG - Intergenic
1140926209 16:79586411-79586433 ACAAAGCAACAGAGGAGGTGGGG - Intronic
1142272605 16:89098369-89098391 CAGATCCCACAGAGGGGGCGTGG + Intronic
1142275881 16:89118720-89118742 TCAATGCCACAGAGTGGCCCAGG - Intronic
1146937207 17:36819314-36819336 AGAATGCCACAGAGCAGGCAGGG + Intergenic
1148243634 17:46016065-46016087 ACAAAGTCACAGAGGGGACATGG - Intronic
1148556604 17:48582255-48582277 AGAAAGGCCCAGAGGGGGCGCGG + Intronic
1148911942 17:50947493-50947515 ACAGTGACACAGCGGGGGCGGGG + Intergenic
1151353072 17:73543002-73543024 CCTATGCTGCAGAGGGGGCGTGG - Intronic
1153872500 18:9334357-9334379 ACACTGCAACTGAGGGGGCCCGG + Intergenic
1157276606 18:46315166-46315188 ACCATGCCACAGAGGAAGCCAGG + Intergenic
1160595394 18:79970082-79970104 ACAGTGCCACAGACGAGGCAAGG + Intronic
1160625666 18:80202935-80202957 ACAATGCAAGAGACGGGGTGGGG + Intronic
1161769109 19:6221881-6221903 CAAATGCCACCGAGGAGGCGAGG + Intronic
1163298102 19:16425332-16425354 ACAATGGCACTGAAGGGGCAAGG + Intronic
1163630543 19:18415963-18415985 AAGGTGGCACAGAGGGGGCGGGG - Intergenic
1163730900 19:18948691-18948713 CCAAGGCCACAGAAGGAGCGTGG - Intergenic
1166777894 19:45323541-45323563 CCAGTGGCACCGAGGGGGCGAGG - Intergenic
1167621080 19:50561177-50561199 ACAATGGCAGAGAAGTGGCGGGG - Intronic
1167696931 19:51020291-51020313 TCACGGCCACAGAGTGGGCGTGG - Intergenic
1168494447 19:56838100-56838122 ATGATGCCACAGAGTGGGCGGGG + Intronic
925225759 2:2182986-2183008 ACTCTGCCACAGAGGTGGGGAGG + Intronic
926137398 2:10346450-10346472 AAAAAGCCACAGAGGGGACTGGG - Intronic
926221011 2:10935435-10935457 AGAATGTGACAGAGGGGGTGAGG - Intergenic
927863700 2:26575911-26575933 AGAAGGCCACAGTGGGGACGTGG - Exonic
928456864 2:31430277-31430299 ACAAGGCCACAGAGGTGGGCAGG - Intergenic
930641591 2:53859561-53859583 AGAATGCCGCAGAGGGGTGGTGG + Intronic
933083883 2:78030005-78030027 ACAATCACACAGAGGGGGATGGG + Intergenic
934176168 2:89581968-89581990 ACCAAGCCATAGGGGGGGCGTGG + Intergenic
936260850 2:110958763-110958785 ACAATGCCACAGAGGACCCTGGG + Intronic
936594474 2:113834808-113834830 ACAAAGAACCAGAGGGGGCGGGG + Intergenic
948671644 2:239572389-239572411 ACAATGGCAAAGATGGGGCCGGG - Intergenic
1171124673 20:22591224-22591246 ACAATGCACCACAGGGGGCATGG - Intergenic
1179234298 21:39531248-39531270 GCAGAGCCTCAGAGGGGGCGTGG + Intergenic
1181583974 22:23842837-23842859 ACAATGCCAGGGAGGTGGCATGG - Intergenic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
954791976 3:53140006-53140028 AGAAAGCCACAGAGGTGGCAGGG - Intergenic
956404830 3:68917424-68917446 ACACTGACACACAGGGGGGGAGG - Intronic
956872868 3:73435367-73435389 AGGAAGCCACAGATGGGGCGGGG + Intronic
961334322 3:126161104-126161126 ACAGAGCCACAGAGGGGACTGGG - Intronic
961497308 3:127304221-127304243 ACTGTACCAGAGAGGGGGCGGGG - Intergenic
961565446 3:127760389-127760411 ACCATGCCACACAGGGCACGTGG + Intronic
968266436 3:197366958-197366980 ACCTCGCCACAGAGGGGGCCTGG - Intergenic
969494907 4:7520923-7520945 CCAATGCCCCAGAGGGGTTGGGG - Intronic
981033467 4:140149371-140149393 AGGCTGCCACAGAGGGGGCTGGG - Intronic
982836581 4:160126095-160126117 AGAGTGCCAGAGAGTGGGCGCGG - Intergenic
983788910 4:171770312-171770334 ACAATGGTACAGAGAGGACGTGG + Intergenic
984951566 4:185011580-185011602 AGAGTGCCACAGAGGAGGGGCGG + Intergenic
992766526 5:80006053-80006075 ACAATGCCACAGGCCGGGCATGG - Intronic
996384785 5:122899702-122899724 ACTATTCAACAGAGGGGGCCAGG - Intronic
997355212 5:133258207-133258229 ACAATGACACAGAGGTTGTGTGG - Intronic
1000981573 5:167822188-167822210 ACAATGTGACCGAGAGGGCGTGG - Intronic
1002633740 5:180596953-180596975 ACGGTGCCACAGAGGGCGCTCGG - Intergenic
1003611518 6:7618737-7618759 ATATGGCCACAGAGTGGGCGAGG - Intergenic
1007952799 6:45886964-45886986 ATGATGCCAGAGAGGGGGCATGG + Intergenic
1009376364 6:62975427-62975449 ACAGTGCCACAGACTGGGCGTGG - Intergenic
1017324436 6:153130361-153130383 CCACAGCCACCGAGGGGGCGAGG - Intronic
1019195762 6:170281784-170281806 ACATGGCCCCAGACGGGGCGTGG - Intergenic
1020215138 7:6184353-6184375 ACAATACCACAGAGGGGGCCAGG - Intronic
1022230517 7:28409021-28409043 ACAAGACCACGGAGGAGGCGCGG - Intronic
1033098913 7:138454149-138454171 AGAATACCACAGAGGGTGAGAGG + Intergenic
1036764970 8:11543679-11543701 GCAATGCCACATAGGGGACAAGG - Intronic
1042220790 8:66472019-66472041 ACAATGCCATAGAGAGGGACAGG - Intronic
1042786895 8:72557759-72557781 ACACTGCCACACAGTGGGCCTGG + Intronic
1042979869 8:74514513-74514535 CCAATGCAACAGTGGGGGTGGGG + Intergenic
1049308058 8:141917953-141917975 ACATTCCCACAGAGGGGCTGCGG + Intergenic
1049693067 8:143971228-143971250 GCAATGCCACAGAGGGGAGGAGG + Intronic
1050253213 9:3767730-3767752 ACAATGCTTCACAGAGGGCGTGG + Intergenic
1051948748 9:22604490-22604512 AGAATACCACAGAGGGGAAGGGG + Intergenic
1053272374 9:36759255-36759277 ACAATGCCAAAGTGGGGGAGAGG + Intergenic
1186223176 X:7371114-7371136 ACCAAGCCACAGAGGAGGCTGGG + Intergenic
1187082970 X:16010748-16010770 ACAGTACCACAGAGGAGGAGAGG - Intergenic
1189292224 X:39894607-39894629 AGAATTCCACAATGGGGGCGGGG + Intergenic
1190505673 X:51123815-51123837 ACAGAGCCATGGAGGGGGCGGGG + Intergenic
1192434677 X:71135956-71135978 AGAAAGCCAGAGAGGGAGCGGGG - Intronic
1192680961 X:73253692-73253714 ACCATGCCACAGAGAGGGGTTGG + Intergenic
1193808954 X:86028378-86028400 ACAATGCCTCTGAGGGGGAATGG + Intronic
1197765570 X:130057441-130057463 ACAATGCCACAGAGGGGGCGGGG - Exonic