ID: 1197766273

View in Genome Browser
Species Human (GRCh38)
Location X:130061035-130061057
Sequence CTCATGGACCCTGTGATCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197766263_1197766273 19 Left 1197766263 X:130060993-130061015 CCTGGTGACAGCAACGCACAGCT No data
Right 1197766273 X:130061035-130061057 CTCATGGACCCTGTGATCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197766273 Original CRISPR CTCATGGACCCTGTGATCCG GGG Intergenic
No off target data available for this crispr