ID: 1197767082

View in Genome Browser
Species Human (GRCh38)
Location X:130066371-130066393
Sequence GCAGCCAGTGAGATAGAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197767080_1197767082 -8 Left 1197767080 X:130066356-130066378 CCCTGTGTAGGGAATGCAGCCAG 0: 1
1: 0
2: 7
3: 821
4: 186
Right 1197767082 X:130066371-130066393 GCAGCCAGTGAGATAGAGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 291
1197767081_1197767082 -9 Left 1197767081 X:130066357-130066379 CCTGTGTAGGGAATGCAGCCAGT 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1197767082 X:130066371-130066393 GCAGCCAGTGAGATAGAGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197767082 Original CRISPR GCAGCCAGTGAGATAGAGCC AGG Exonic
900989819 1:6093190-6093212 GCAGGCACTGAGGGAGAGCCAGG + Intronic
902219469 1:14955741-14955763 GCAGAGAGTGAGATGGAGCTGGG - Intronic
902292925 1:15446918-15446940 GCAGCTTGTGAGATGGAGCGGGG - Intronic
902313104 1:15597061-15597083 GCAGCAAGAGAGAGAGAGACAGG - Intergenic
903385253 1:22921887-22921909 GGAGTCAGTGAGATAGAGCATGG + Intergenic
904413032 1:30336391-30336413 GCAGCAAGTCTGACAGAGCCAGG - Intergenic
905362592 1:37430858-37430880 GCATCCAAGGAGATAGTGCCAGG + Intergenic
905736248 1:40328423-40328445 CCAGCCAGTGTGACAGAGCCAGG - Intergenic
906649313 1:47501319-47501341 CCAGCCAGGGTGACAGAGCCAGG - Intergenic
907298377 1:53470116-53470138 CCAGCCAGTGAGGGAGAGGCTGG - Intergenic
907633278 1:56106416-56106438 GCAGCCAGTGAAATTGGGCAGGG + Intergenic
908654747 1:66376146-66376168 TCAGCCAGTAAGATAAAACCAGG - Intergenic
909676096 1:78240823-78240845 GCAAACGGTGAGATACAGCCAGG + Intergenic
910246352 1:85142855-85142877 GTGCCCAGTGAGAGAGAGCCAGG - Intergenic
912542017 1:110423963-110423985 GTAGCAAGTGAGATGGAGCAGGG - Intergenic
913280245 1:117178621-117178643 GCAGTCAGGGGAATAGAGCCGGG - Intronic
915536147 1:156537060-156537082 GCAGGGAGGGAGATGGAGCCAGG - Intronic
915970775 1:160353571-160353593 GCAGCGAGTGTGACACAGCCAGG - Intronic
916593996 1:166224987-166225009 GCAGCTAGAGAGATAGAGGCAGG - Intergenic
919720683 1:200830887-200830909 GTAGCCAGTGAGAGAAATCCAGG + Intronic
921183756 1:212652643-212652665 GGAGCCATGGGGATAGAGCCTGG + Intergenic
922226766 1:223652310-223652332 CCAGCCTGGGAGACAGAGCCAGG + Intronic
922726742 1:227926330-227926352 GCACCCAGTGGGGTGGAGCCGGG - Intronic
922872702 1:228916108-228916130 GGAGCAAGTGAGAGAGAGTCAGG - Intergenic
923454465 1:234151196-234151218 CCAGGGAGGGAGATAGAGCCAGG + Intronic
923859263 1:237876670-237876692 GCAGCCTGTGTGATAGAGCAAGG + Intergenic
1063032456 10:2249430-2249452 TCAGCCAGTGATTTACAGCCTGG + Intergenic
1063238443 10:4143530-4143552 CCAGCCTGGGAGACAGAGCCAGG - Intergenic
1063272472 10:4526516-4526538 GCAGTCTGTGAGTTAGAGGCTGG - Intergenic
1063748911 10:8920060-8920082 CCAGCCTGGGAGATAGAGCAAGG - Intergenic
1064286727 10:13998040-13998062 GCAGCCAGTGAGGTAGAAAGAGG - Intronic
1064447307 10:15407143-15407165 GCAGGCAGTGCTAGAGAGCCTGG + Intergenic
1064877806 10:20015038-20015060 GCAGTCCGTGAGATAAAGCCAGG + Intronic
1066385906 10:34940975-34940997 CCAGCCAGGGTGACAGAGCCAGG + Intergenic
1067216561 10:44309111-44309133 GCAGTCAGTGAGAGGGATCCAGG - Intergenic
1067932899 10:50581241-50581263 GCAGCCAGTGGTAGAGACCCTGG + Intronic
1068512655 10:57985725-57985747 CCAGCCAGGGCGACAGAGCCAGG + Intergenic
1068913182 10:62400513-62400535 GCAGCTATTAAGATAGAGGCTGG - Intronic
1069554039 10:69385048-69385070 GCAGGCTGTGAAATAAAGCCTGG - Intronic
1069587933 10:69620963-69620985 GCAGGCAGTGAGAGACTGCCTGG + Intergenic
1069769490 10:70888371-70888393 GCCGCCAGCGACAGAGAGCCGGG + Intronic
1070158869 10:73853416-73853438 GCAGCCTGGGAGCCAGAGCCTGG + Intronic
1070534043 10:77362014-77362036 GCAGCCACTGAGGGAGACCCTGG - Intronic
1071681174 10:87707105-87707127 CCTGCTAGTGAGACAGAGCCAGG - Intronic
1071904856 10:90161578-90161600 GCAGCCAGAGAGGGAGAGCTAGG - Intergenic
1072310054 10:94145931-94145953 AAAGCAAGTGAGATAGTGCCAGG + Intronic
1072682750 10:97518328-97518350 GCAGCTAGGGAGAAAGAACCAGG - Intronic
1072893705 10:99347663-99347685 GGTGCCAATGTGATAGAGCCAGG - Intronic
1073026432 10:100490178-100490200 TCAGGCAGGGAGGTAGAGCCAGG + Exonic
1073324064 10:102632418-102632440 AGAGCCAGTGAGATGGAGCCTGG - Exonic
1075713539 10:124543196-124543218 GCAGCCAGGGAGGTGGAGTCTGG - Intronic
1075913459 10:126146269-126146291 GCAGCCTGTGAGGGAGAGGCAGG + Intronic
1075924020 10:126235992-126236014 GCAGACAGGGAGACAGAGCTGGG + Intronic
1076563225 10:131381123-131381145 GAGGCCAGTGAGATGGAGGCTGG + Intergenic
1076916716 10:133426029-133426051 GGAGCCAGTGAGATGGGGGCAGG + Intergenic
1076936820 10:133570824-133570846 GGAGCCAGTGAGATGGGGGCAGG + Intergenic
1077017970 11:405272-405294 GCAGCCAGTGTGAGAGCCCCTGG - Intergenic
1078131878 11:8620207-8620229 GCATCCTGTGGGACAGAGCCAGG - Intronic
1078272125 11:9805650-9805672 GCAGCCTGGGAGACAGAGCGAGG - Intronic
1079251186 11:18789416-18789438 ACAGCCAGTGAGGAAGAGACTGG + Intronic
1081429463 11:42960595-42960617 GCTGGCAGAGAGACAGAGCCAGG + Intergenic
1081523942 11:43910883-43910905 GAAGACAGTGAGAGAGAGGCAGG - Intronic
1081666857 11:44921625-44921647 GCATCCAGAGAGAAGGAGCCTGG + Intronic
1081939082 11:46925440-46925462 GCAGACAGTCAGCTAGGGCCAGG + Intergenic
1082104964 11:48211548-48211570 GCAGTAAGTGAGAGAGAGCCTGG - Intergenic
1083714762 11:64568857-64568879 GCAGCCAGGGAAATGCAGCCAGG + Intronic
1083966281 11:66045769-66045791 GCAGGCAGAGAGACAGAGACAGG - Intronic
1084561366 11:69907331-69907353 GAAGCCAGTGGGATGGAGCCTGG + Intergenic
1089756369 11:120690536-120690558 GCAGCCAGGCAGCTGGAGCCAGG + Intronic
1090184761 11:124730023-124730045 CCAGCCTGGGAGACAGAGCCTGG - Intergenic
1090668952 11:128932885-128932907 GCAGCCTGGGTGACAGAGCCAGG + Intergenic
1090886183 11:130878933-130878955 ACAGGCAGTGAGGTAAAGCCAGG + Intronic
1091526113 12:1303124-1303146 GCAGCCATCAAGATAGAGGCAGG - Intronic
1093676515 12:21946469-21946491 GCAGCCACAGAGATAGGGTCTGG - Intergenic
1095099034 12:38162581-38162603 AGAGCCAGAGCGATAGAGCCTGG + Intergenic
1095205280 12:39432638-39432660 CCAGCCTGCGTGATAGAGCCAGG - Intronic
1095354163 12:41251885-41251907 GCAGGCAGACAGCTAGAGCCAGG + Intronic
1096691218 12:53323066-53323088 CAAGCCAGAGAGAAAGAGCCGGG + Intronic
1096828834 12:54299287-54299309 GCAGGCAGTGGGATAGATCAGGG + Intronic
1097418022 12:59337885-59337907 GCAGCAAGGAAGATAGAGCAAGG - Intergenic
1103933099 12:124460871-124460893 GCAGCCAGGGAGACAGTGTCGGG - Intronic
1104387276 12:128361969-128361991 GCAGCCTGCTAGAGAGAGCCAGG + Intronic
1104713707 12:131003395-131003417 GCAGTCAGGGAGACAGAGCATGG - Intronic
1104733466 12:131121853-131121875 GCAGCCAATGAGAACCAGCCTGG - Intronic
1104929668 12:132331616-132331638 GCAGCCAGTGTGATAAACCCTGG + Intergenic
1106932829 13:34685101-34685123 CCAGCCTGTGTGACAGAGCCAGG + Intergenic
1107060479 13:36154821-36154843 GCAGCCTGTGAGCCAGCGCCTGG - Intergenic
1108249797 13:48552576-48552598 GCAACAATTGAGAAAGAGCCTGG + Intergenic
1108493607 13:51004149-51004171 ATAGGCAGTGAGAAAGAGCCGGG - Intergenic
1111798607 13:92955723-92955745 GCAGCCATTGAGAGAGAGAACGG + Intergenic
1112130252 13:96515694-96515716 GCAGCAGGTGAGAGAGAGCATGG - Intronic
1112158624 13:96845719-96845741 GCATGCAGTGAGGTAGAGCTGGG - Intergenic
1112800702 13:103106957-103106979 GTAGCCAGGGCCATAGAGCCTGG + Intergenic
1113940561 13:114016498-114016520 GCAGCCAGTGACACAGGCCCAGG - Intronic
1114602165 14:23965835-23965857 ACAGAGAGTGAGAGAGAGCCTGG + Intronic
1114606334 14:24000936-24000958 ACAGAGAGTGAGAGAGAGCCTGG + Intronic
1114611886 14:24048229-24048251 ACAGAGAGTGAGAGAGAGCCTGG + Intergenic
1114773170 14:25451875-25451897 GCAGCCAGGGGGATAGAGCAGGG + Intergenic
1115201861 14:30862266-30862288 TCAGCCAGTCAGCTAGGGCCGGG + Intergenic
1116646395 14:47534510-47534532 GCAGCAAGTGAGAGAGAGCCAGG + Intronic
1117193494 14:53316827-53316849 GGCCCCTGTGAGATAGAGCCAGG + Intergenic
1118675962 14:68184578-68184600 CCAGCCAGGGTGATAGAGCAAGG + Intronic
1120831882 14:89004639-89004661 GCAGCAAGTTAGAAGGAGCCTGG + Intergenic
1121718437 14:96092515-96092537 ACAGCCAGTGAGACAGATACAGG - Exonic
1123499608 15:20867513-20867535 GCAGCCTGTGAGCTGGACCCAGG + Intergenic
1123556860 15:21441243-21441265 GCAGCCTGTGAGCTGGACCCAGG + Intergenic
1123593083 15:21878479-21878501 GCAGCCTGTGAGCTGGACCCAGG + Intergenic
1123878377 15:24649305-24649327 GGAGCAAGAGAGAGAGAGCCGGG + Intergenic
1124396422 15:29305953-29305975 GCAGCCAGTGAGGTAGGGAAGGG + Intronic
1124468905 15:29965982-29966004 GTAGGCAGTGAGTTAGGGCCAGG - Intronic
1125837533 15:42765857-42765879 GCAGCCAGAGAGAAAGGGCCAGG + Intronic
1128783578 15:70378839-70378861 TCAGCCAGTGAGTTAGAGCCAGG + Intergenic
1129766927 15:78175581-78175603 GTAGCAAGTGAGACAGAGGCTGG + Intronic
1130016746 15:80193292-80193314 GCAGCCAGAGAGCATGAGCCTGG - Intergenic
1132361540 15:101220300-101220322 GCAGTTAGGGAGATAGAGGCAGG - Intronic
1202965203 15_KI270727v1_random:168432-168454 GCAGCCTGTGAGCTGGACCCAGG + Intergenic
1132903992 16:2272815-2272837 GCAGCCAGTAAGACAGAGATGGG + Intergenic
1133045636 16:3087008-3087030 GCAGCCGGTGAGATAAAGATGGG + Intergenic
1134665549 16:16015935-16015957 ACAGCCAGTGTGAGAGAGCCAGG + Intronic
1137239448 16:46642620-46642642 CCAGCCAGTGTCATAGAGACAGG + Intergenic
1139131353 16:64149792-64149814 GCAGACAGAGAGATGGAGACAGG + Intergenic
1139670726 16:68491148-68491170 GCAGCCAGTGTGGAACAGCCAGG + Intergenic
1141323548 16:83034869-83034891 GCAGCAAGCGAGAAACAGCCAGG - Intronic
1142305804 16:89284753-89284775 GAAGCCAGTGAGGAAGAGGCAGG - Exonic
1142694006 17:1623504-1623526 GAAGCCAGGGAGATAGAGGAGGG - Intronic
1143265854 17:5636901-5636923 ACAGCCAGAGTGATAGAGTCAGG - Intergenic
1144763407 17:17720228-17720250 GCAGCTATTGAGATAGTGCTTGG + Intronic
1144938576 17:18919892-18919914 GAAGGCAGTGAGATAGAGCCAGG + Intronic
1145924885 17:28639376-28639398 GCAGCCAGTGAGAGAATTCCTGG + Exonic
1146619588 17:34387129-34387151 GCAGCAAGCAAGAAAGAGCCAGG + Intergenic
1146638365 17:34522357-34522379 GCAGGAAGTGAGAGAGATCCTGG - Intergenic
1148338283 17:46856338-46856360 GCATCCACTGAGAGTGAGCCTGG - Intronic
1149219414 17:54398887-54398909 GCAGCGAGAGAGAGAGAGCAAGG + Intergenic
1149639585 17:58193990-58194012 GCAGCCAGCGAGCCAGAGCCTGG - Exonic
1149657337 17:58317164-58317186 GCAGCCTGGGGGATAGAGCGAGG + Intronic
1150072251 17:62161658-62161680 GCAGCAAGAGAGAGAGAGTCTGG - Intergenic
1151443675 17:74149759-74149781 GCAGCCAGGGAGATGTGGCCGGG - Intergenic
1151575397 17:74950497-74950519 GCAGCCACTGAGACAGCGCTGGG - Intergenic
1152320578 17:79606921-79606943 GGAGACAGGGAGATAGACCCAGG + Intergenic
1152590737 17:81210675-81210697 GCGACCAGTGATATAGATCCTGG + Intronic
1153870030 18:9309921-9309943 CCAGCCTGGGAGATAGAGCAAGG - Intergenic
1154457665 18:14544388-14544410 GCAGCCTGTGAGCTGGACCCAGG + Intergenic
1156072562 18:33230446-33230468 GCAGCCAAGGAGATAGAGGAGGG - Intronic
1157792252 18:50543034-50543056 GAAGCCAGGGAGAGTGAGCCTGG - Intergenic
1157824332 18:50799258-50799280 GCATCCAGTGAGATAAAACAGGG + Exonic
1158614739 18:58976572-58976594 CCAGCCTGTGAGACAGAGCAAGG - Intronic
1160529033 18:79552899-79552921 GCAGCCACTGGGAACGAGCCTGG + Intergenic
1161450221 19:4341693-4341715 CCAGCCTGGGAGATAGAGCAAGG + Intronic
1165178435 19:33947236-33947258 GCTGCCAGGGACACAGAGCCAGG - Intergenic
1166525894 19:43509465-43509487 CCAGCCTGGGAGATAGAGCGCGG + Intronic
1167793777 19:51695961-51695983 GGAGCCTGAGAGAAAGAGCCGGG + Intergenic
925978058 2:9155002-9155024 GCAGAGAGTAAGATAGAGCGGGG - Intergenic
926739908 2:16102505-16102527 CCAGACAGTGAGAAAGAGACGGG - Intergenic
926994771 2:18722524-18722546 ACAGCCAGTGGGAGAGAGCCAGG - Intergenic
928373397 2:30757213-30757235 GCAGCCAGTGAGGCTCAGCCTGG - Intronic
929431992 2:41894966-41894988 GCATCCCGGGAGACAGAGCCAGG + Intergenic
931484718 2:62679046-62679068 TCAGCTAGTGAGATACGGCCTGG + Intronic
932323310 2:70837792-70837814 GCAGGCAGTGATGTGGAGCCAGG - Intergenic
932711756 2:74070743-74070765 GCAGGCAGATAGATTGAGCCCGG + Intronic
933052235 2:77613698-77613720 GCAGCCAGAGAGAAAGACCGAGG + Intergenic
934013758 2:87855631-87855653 GCAGGCAGGGAGATGGAGCCTGG + Intergenic
934033635 2:88069542-88069564 GCTGCCAGTGAGTTACTGCCTGG + Intronic
934623057 2:95827637-95827659 GCAGCCAGAGAGAAAGGGGCAGG - Intergenic
935779279 2:106497241-106497263 CCAGCCTGGGTGATAGAGCCAGG + Intergenic
935854135 2:107256760-107256782 CCAGCCAGTTCCATAGAGCCTGG - Intergenic
936692006 2:114901225-114901247 CCAGCCTGGGTGATAGAGCCAGG - Intronic
938058843 2:128236606-128236628 GCAGCCAGGGAGATGGAGTGAGG + Intergenic
938934531 2:136116939-136116961 GCACCCTGTGGGACAGAGCCTGG - Intronic
940889174 2:159018075-159018097 GCAGCCAGTTACATAGTGCTTGG + Intronic
942718174 2:178918376-178918398 CCAGCCAGGGTGACAGAGCCAGG + Intronic
943563770 2:189493913-189493935 GCAGCCAGTGAAATATGGGCAGG + Intergenic
944408691 2:199414907-199414929 GCAGGCTGTGACAGAGAGCCAGG + Intronic
945517915 2:210785670-210785692 CAAGCAAGTGAAATAGAGCCAGG + Intergenic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
947127887 2:226890976-226890998 GTGGTTAGTGAGATAGAGCCAGG - Intronic
948048209 2:234959373-234959395 GCAGAGAGAGAGAGAGAGCCTGG + Intronic
1169488679 20:6053761-6053783 GAAGGCAGTGAGAAAGATCCTGG + Intronic
1171368756 20:24646480-24646502 GCTGCCTGTTAGAAAGAGCCTGG + Intronic
1172026127 20:31950049-31950071 GCAGACACTGAGAGAGTGCCGGG - Intronic
1173976356 20:47189549-47189571 GCATCCAATCAGATAGACCCAGG - Intergenic
1175459040 20:59137049-59137071 GCAACCAGTTAGAAGGAGCCTGG + Intergenic
1176209698 20:63913072-63913094 GCAGACAGGGAGATGGAGACGGG - Intronic
1176267330 20:64217022-64217044 ACAGCCAGTGAGATGGGACCTGG - Intronic
1176868471 21:14069869-14069891 AGAGCCAGAGTGATAGAGCCTGG - Intergenic
1176981696 21:15388855-15388877 GCAGCCAGAGAAAAAGAGACAGG + Intergenic
1179593833 21:42429102-42429124 GCAGCCAGAGAGGCAGAGACTGG + Intronic
1179652064 21:42817679-42817701 GCACTCAGTGACATGGAGCCCGG - Intergenic
1180092699 21:45541276-45541298 GCGGCCAGTGAGATGCAGCCTGG + Intronic
1180636958 22:17269263-17269285 ACAGCCACTGAAACAGAGCCAGG + Intergenic
1181638630 22:24185633-24185655 GGAGCCAGTGAGTCAGGGCCAGG - Intronic
1183342011 22:37286726-37286748 GCAGCCAGGGAGGCAGAGCACGG + Intronic
1183711762 22:39508580-39508602 GTGGCCACTGAGATAGAGACGGG - Intronic
1184158387 22:42683808-42683830 GCAGCCAGGGAGGCCGAGCCAGG + Intergenic
1184166827 22:42734438-42734460 ACAGCCAATGAGTTATAGCCAGG - Intergenic
1184178546 22:42803931-42803953 CCAGCCTGGGTGATAGAGCCAGG - Intronic
1184823380 22:46930162-46930184 GGAGACAGTGAGAAGGAGCCAGG - Intronic
950117048 3:10457879-10457901 GCAGGCAGTGAGAGGGATCCAGG + Intronic
950523991 3:13513057-13513079 CCAGCCAGGGTGGTAGAGCCCGG + Intergenic
951883773 3:27504408-27504430 GCATCCAGTGAGGTGGAACCAGG + Intergenic
953910163 3:46888824-46888846 GCAGGCAGTGGGATGCAGCCTGG - Intronic
956718887 3:72100958-72100980 GCAACCAGTGAGCGGGAGCCCGG + Intergenic
957922196 3:86760152-86760174 GTAGCCAGTGAGATATAATCAGG + Intergenic
958099838 3:88995238-88995260 GCAGCCAGTGTGACAGAGCAAGG + Intergenic
959735835 3:109656885-109656907 GCAGCCATGGAGACAGAGACTGG - Intergenic
961260070 3:125595278-125595300 GCAGCCCCCGAGATACAGCCAGG + Intergenic
961359588 3:126358391-126358413 GCAGGTAGAGAGGTAGAGCCAGG + Intergenic
961537407 3:127578515-127578537 GCAGGCAGGGAGAAAGAGCCAGG - Intronic
961563912 3:127749969-127749991 GAGGCCAGTGAGTTGGAGCCAGG + Intronic
962263847 3:133931760-133931782 GCTGTCAGTGCAATAGAGCCTGG - Intergenic
962986337 3:140539631-140539653 GCAGTCAGTGATAGAGAGCAAGG - Intronic
964164735 3:153689326-153689348 GCAACCAGTAAGAAAGAGCTCGG - Intergenic
965838998 3:172881705-172881727 GCAGCAAGTTAGGTAGAGCTGGG + Intergenic
967481529 3:189978949-189978971 GCAACCAGAGAGTCAGAGCCAGG - Intronic
969411864 4:7033731-7033753 GCAGCCACTGAGGGAGAGGCGGG - Intergenic
969515446 4:7645579-7645601 ACAGACAGTGTGAGAGAGCCTGG - Intronic
969622658 4:8286536-8286558 GCAGCCAGGGAGACACAGGCGGG - Intronic
969637716 4:8378978-8379000 GCAGCCACTGACCTGGAGCCAGG - Intronic
970000192 4:11357347-11357369 GCAGGCAGAGAGAAAGAGCTTGG - Intergenic
970424157 4:15930962-15930984 CCTGCCTGTGAGATGGAGCCTGG - Intergenic
970896283 4:21108003-21108025 GCAGCCAGAGAGAAAGGGTCGGG - Intronic
971481745 4:27121016-27121038 GCAGCCAGCAAGATAGAGTCAGG + Intergenic
972912618 4:43836644-43836666 TGAGCCAATTAGATAGAGCCAGG - Intergenic
973073500 4:45894813-45894835 GCAGCAGGTGAGATAGAGCAGGG - Intergenic
973589801 4:52429557-52429579 GCAACAAGGGAGAAAGAGCCTGG - Intergenic
974705678 4:65512552-65512574 GCAGCAAGAGAGACAGAGCGGGG - Intronic
974866552 4:67588437-67588459 CCAGCCTGTGAGACAGAGCGAGG - Intronic
975395730 4:73870908-73870930 CCAGCCACTGTGATAGAGGCTGG + Exonic
976627672 4:87204664-87204686 GCAGCCATTGAGATTCATCCAGG - Intronic
983114504 4:163796254-163796276 CCAGCCTGTGTGACAGAGCCAGG - Intronic
986067438 5:4248850-4248872 TCAACCAGTGAGAGAGAGACCGG + Intergenic
986111575 5:4724200-4724222 GCAGTTAGGGAGATAGACCCTGG - Intergenic
988978748 5:36542672-36542694 CCAGCCTGTGAGACAGAGCGAGG + Intergenic
989080108 5:37609628-37609650 GAAGGCAGTCAGATAGAGCAGGG - Intronic
989407994 5:41083190-41083212 GCAGCCAGTGATGTAGGGACAGG + Intergenic
990299231 5:54434060-54434082 GCAGACATTGAGATGGAGCTGGG + Intergenic
992812060 5:80398631-80398653 GCAGTAAGTGAGATCCAGCCTGG - Intergenic
995149931 5:108830831-108830853 GTTGGGAGTGAGATAGAGCCAGG + Intronic
996626808 5:125580011-125580033 GCAGCCTGGGTGACAGAGCCAGG - Intergenic
996668421 5:126087701-126087723 GCAGCCAGAGAGAAAAAGTCGGG + Intergenic
996686848 5:126292220-126292242 GCAGCCAGAGAGAAAAAGTCGGG + Intergenic
999855440 5:155588276-155588298 GCAGGCAGTGAGACAAAGACAGG + Intergenic
1000443284 5:161287770-161287792 CCAGCAAGAGAGAAAGAGCCTGG - Intergenic
1001436632 5:171704400-171704422 GCAGCCTGGGAGCTGGAGCCAGG - Intergenic
1002918447 6:1547872-1547894 GCAGGCAGTGAGAAGGTGCCAGG - Intergenic
1003639120 6:7861889-7861911 GCAGCGAGTAAGAGAGAGGCAGG + Intronic
1004313037 6:14562616-14562638 GCAGGCAGTAAGATAGGGCTTGG + Intergenic
1004917809 6:20348136-20348158 GCAGCATGTGGGATAGATCCTGG + Intergenic
1005578935 6:27215513-27215535 GCAGCCAGTGCGCTCCAGCCTGG - Intergenic
1007250010 6:40489153-40489175 GAAGGCAGTGAGATGGAGGCAGG - Intronic
1007730523 6:43942716-43942738 CCAGCAAGTGAGATGGAGCCAGG + Intergenic
1008573091 6:52833471-52833493 GAACCCAGGGAGATAGAGCAGGG - Intronic
1008603203 6:53115853-53115875 GAAGCCAGAGAGAGAGAGACAGG + Intergenic
1009386830 6:63094949-63094971 GCAGCCAATGAGAGAGACTCAGG - Intergenic
1010368664 6:75081959-75081981 GCAGCAAGATAGAAAGAGCCTGG + Intergenic
1011059842 6:83252321-83252343 CCAGCCTGTGTGACAGAGCCAGG - Intronic
1011544360 6:88467699-88467721 GCAGCAAGAGAGAGAGAGCAAGG - Intergenic
1011626619 6:89288344-89288366 GAAACCAGTGAGAGAGAGCAAGG + Intronic
1012955649 6:105566963-105566985 GCAGAGAGAGAGAAAGAGCCAGG - Intergenic
1013635075 6:112021372-112021394 TCAGCAAGAGAGATAGACCCAGG - Intergenic
1013889110 6:115004781-115004803 ACAGAGAGTGAGAAAGAGCCAGG - Intergenic
1017053890 6:150420539-150420561 GCAACCAGTTTGAAAGAGCCTGG - Intergenic
1018246394 6:161828578-161828600 GCAGCCAGTGAGAAACAGAGGGG - Intronic
1019326022 7:438669-438691 GCAGCCCTTGGGATGGAGCCAGG + Intergenic
1019689142 7:2400251-2400273 GCAGCCAGCCAGAAGGAGCCTGG + Intergenic
1020442466 7:8233050-8233072 GGAGACAGTGAGATCAAGCCAGG + Intronic
1021669803 7:23023763-23023785 TCAGCCAATGAGATATAGCCAGG + Intergenic
1021731373 7:23598135-23598157 GCAGGCAGTGAGAGAAACCCAGG - Intronic
1024052965 7:45640946-45640968 TCAGACTGTGAGATAGAGCAGGG - Intronic
1024294856 7:47833699-47833721 GCCGCCAGAGAGTTAGAGCCTGG + Intronic
1024671798 7:51602487-51602509 GCAGGCACTGAGATGGAGCCAGG - Intergenic
1025861944 7:65338521-65338543 GCAGCAGGTGAGCTAGAGCATGG - Intergenic
1026270567 7:68832984-68833006 CCAGCCAGGGCGATAGAGCGAGG - Intergenic
1026436591 7:70404350-70404372 GAAGCCAGAGAGATATAGACAGG - Intronic
1027348270 7:77284322-77284344 GAAGCCAGTGAAATCGAGCTAGG - Intronic
1028196138 7:87910342-87910364 CCAGCCAGTGAGATGAAGGCAGG + Intergenic
1028428699 7:90721580-90721602 GCAGGAAGTGTGAAAGAGCCAGG - Intronic
1028505759 7:91568598-91568620 GGAGCCAGTGTGATAGAAGCTGG + Intergenic
1029427457 7:100505142-100505164 GCAACCAGTTAGAAAGAGCCTGG - Intergenic
1030353418 7:108516870-108516892 CCAGCCTGGGTGATAGAGCCAGG + Intronic
1032751138 7:134843016-134843038 GCAGCCAGTGGCAAACAGCCAGG - Intronic
1035206171 7:157295291-157295313 GCAGCCTGTGAGGAAGAGCAAGG + Intergenic
1035637559 8:1157854-1157876 GCAGCATCTGAGATAGCGCCTGG - Intergenic
1035640692 8:1182865-1182887 GCATCCAGTGAGGTGGAGCGGGG + Intergenic
1035722674 8:1803654-1803676 ACAGCGAGTGTGAGAGAGCCTGG - Intergenic
1037698474 8:21249403-21249425 CCAGGCAGTGAGAGTGAGCCTGG - Intergenic
1039090535 8:33823875-33823897 CCAGCCTGGGAGACAGAGCCAGG + Intergenic
1041370752 8:57158123-57158145 GCAGCCATCTAGATGGAGCCTGG + Intergenic
1044444211 8:92255204-92255226 GCAGACAGTGAAATAATGCCAGG + Intergenic
1046566030 8:115902704-115902726 GCATGCACTGAGATAAAGCCAGG + Intergenic
1046584477 8:116134367-116134389 ACAGGCAGTGAGATGAAGCCAGG + Intergenic
1046819057 8:118616698-118616720 GCTGCCAGTGGTATAGAGCAGGG + Intronic
1047577463 8:126173125-126173147 GAAGCCAGTGAGATAGACTTAGG + Intergenic
1048228545 8:132614311-132614333 GCAGCCTCTGAGATGGTGCCAGG + Intronic
1048405697 8:134118015-134118037 GCAGCCAGGGAGAGAGAGCAAGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049184515 8:141242701-141242723 GCAGCCTGTGAGTGAGAGCAGGG - Intronic
1049530903 8:143154512-143154534 GCAGACAGTGAGACAGAGGGAGG - Intergenic
1052564373 9:30128805-30128827 GAAGCCAGTAAGATAGAGTAGGG + Intergenic
1057282284 9:93721607-93721629 CCATCCAGTCAGAGAGAGCCTGG + Intergenic
1059629581 9:116106367-116106389 GAAGCCTGTGGGATAAAGCCAGG - Intergenic
1060145174 9:121246772-121246794 TCAGCCATTCAGATAGAGACAGG + Intronic
1060989172 9:127838474-127838496 TCAGGCAGAGAGAGAGAGCCGGG - Intronic
1061585904 9:131568205-131568227 GCAGCCATTGAGCCAGAGCAAGG + Intergenic
1061887388 9:133598742-133598764 GCAGCCTGAGAGTTAGAGACAGG + Intergenic
1062715437 9:138007923-138007945 GGAGCCAGGGAGATGGAGACAGG - Intronic
1185522852 X:754728-754750 CCAGCCAGAGTGATAGAGCGAGG - Intergenic
1185946983 X:4387778-4387800 TCAGCCTGTGAGTGAGAGCCTGG + Intergenic
1186618726 X:11215338-11215360 GGAGCCATTGAGACAGAGCTCGG - Intronic
1187225873 X:17375229-17375251 CCAGCCAGGGAGAGAGATCCCGG + Intergenic
1192260849 X:69505160-69505182 GCAGCCCCCGAGGTAGAGCCTGG + Intergenic
1192553246 X:72070208-72070230 GCAGCATATGAGGTAGAGCCAGG - Intergenic
1194660109 X:96621506-96621528 GCAGCCACTGAGATTCAGCTGGG - Intergenic
1197767082 X:130066371-130066393 GCAGCCAGTGAGATAGAGCCAGG + Exonic
1197863908 X:130998039-130998061 GCAGCCACTGAGAAAGGGTCTGG + Intergenic
1198196648 X:134370041-134370063 GCAGCCAGAGAGCCAGAGTCAGG + Intergenic
1198957067 X:142145004-142145026 GCAGGCAGTGAGATGGTGCTGGG + Intergenic
1198957248 X:142146648-142146670 GCAGGCAGTGAGATGGTGCCGGG + Intergenic
1199130716 X:144182842-144182864 GCGGGCAGGGAGATGGAGCCTGG - Intergenic
1199351003 X:146799915-146799937 GCAGACAGAGAGAAAGAGACGGG - Intergenic
1199466600 X:148144892-148144914 GCAGAAAGGGAGATAGACCCCGG - Intergenic
1199850748 X:151723557-151723579 TCATCCAGTGAGACAGGGCCTGG + Intergenic
1200352342 X:155511270-155511292 GGAGCAAGTGAGAGAGAGTCAGG - Intronic