ID: 1197772141

View in Genome Browser
Species Human (GRCh38)
Location X:130095961-130095983
Sequence TCTACCACAGAGAATAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197772141 Original CRISPR TCTACCACAGAGAATAGGGT GGG (reversed) Intronic
900748378 1:4377050-4377072 TATACCACAGAAAAGGGGGTGGG + Intergenic
903492568 1:23740615-23740637 TCTCCCAAACAGAATAGGATGGG + Intergenic
904665402 1:32116862-32116884 TGTATCTCAGGGAATAGGGTGGG + Intronic
905154525 1:35964274-35964296 TCTACCAGAGGGTAGAGGGTAGG - Intronic
906672788 1:47668940-47668962 TCTACTACCTAGTATAGGGTTGG + Intergenic
909631883 1:77776458-77776480 TCCTCCACAGAGGATAGGGTAGG - Intergenic
911131389 1:94391944-94391966 TCTGCCACACAGAAAACGGTGGG + Intergenic
920791292 1:209095481-209095503 TCTACCACAGAGATTAGTTTAGG + Intergenic
921840720 1:219825489-219825511 TATACCAGTGAGATTAGGGTGGG - Intronic
922979608 1:229814471-229814493 TCTCCCACAGAGAAGAGGGCCGG - Intergenic
924020169 1:239772541-239772563 TAAACAGCAGAGAATAGGGTCGG - Intronic
1066037022 10:31501623-31501645 TCTCCCACAGATAATGGGGGGGG - Intronic
1069246317 10:66211640-66211662 TCTACTGCAGATATTAGGGTTGG - Intronic
1070652726 10:78249641-78249663 TTTAACATACAGAATAGGGTAGG - Intergenic
1074805625 10:117048440-117048462 TCTGCCTCAGAGAAGGGGGTAGG - Intronic
1078851312 11:15166534-15166556 TCTAGAGCAGAGGATAGGGTGGG + Intronic
1081481090 11:43489832-43489854 TCTACCATAGAGACGAGGATGGG + Intronic
1081563113 11:44237562-44237584 CCAACCACAGACAATGGGGTAGG - Intronic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1086051001 11:82590203-82590225 TCTAGCAAAGAGAACAGGGATGG + Intergenic
1086876281 11:92099619-92099641 TCTACCACAGAAAAATGGTTTGG + Intergenic
1087969605 11:104463422-104463444 TCACCCACAGAGTATAGAGTAGG + Intergenic
1089107403 11:116024189-116024211 GCTACCAGAGAGGATAGGGAAGG - Intergenic
1090999534 11:131897356-131897378 TCTACCAGTGAGCAAAGGGTTGG + Intronic
1091276113 11:134351948-134351970 TCTACCTTATAGAATAAGGTAGG + Intronic
1096798192 12:54091562-54091584 TCTCCCACAGCCAACAGGGTAGG + Intergenic
1099844209 12:88008214-88008236 TCTACCAGAGGGTAGAGGGTTGG - Intronic
1101101098 12:101393625-101393647 TTTATCACAAAGAATAGGATGGG - Exonic
1103347446 12:120260566-120260588 AAGACAACAGAGAATAGGGTGGG + Intronic
1106238986 13:27893351-27893373 TCTAGAACAGACCATAGGGTAGG - Intergenic
1106315342 13:28588645-28588667 TGCACCACAGAGAATTGGTTAGG + Intergenic
1112945040 13:104918216-104918238 TCTTCCTAAGAGAAAAGGGTGGG + Intergenic
1113946439 13:114046895-114046917 TATAGCACAAAGAAAAGGGTCGG - Intronic
1115395996 14:32909235-32909257 TCTACCCCAGAGGATGAGGTAGG + Intergenic
1115526040 14:34281641-34281663 TAAACAACAGAAAATAGGGTTGG + Intronic
1119610159 14:76054961-76054983 TCTACCACAGTCCACAGGGTAGG - Intronic
1120428651 14:84385015-84385037 TAAACCAAAGAGAATAGGGGTGG + Intergenic
1202870345 14_GL000225v1_random:157217-157239 CCTACATCAGAGAAGAGGGTGGG + Intergenic
1125440179 15:39693431-39693453 TCAAACACAGCGAATAAGGTGGG - Intronic
1127751317 15:62047599-62047621 TCTAATACAAAGAATAGGGGAGG + Intronic
1129825953 15:78635099-78635121 TCTAGGGGAGAGAATAGGGTGGG + Intronic
1130612363 15:85372817-85372839 TCTTCCAGAAAGAACAGGGTAGG - Intergenic
1138181197 16:54941182-54941204 ACTAACACAGAGACTAGGATAGG - Intergenic
1138225411 16:55290407-55290429 AATACAACAGAGAATGGGGTTGG + Intergenic
1140742663 16:77955426-77955448 TCTTCAACAGAGAATGGGGCCGG + Intronic
1142494325 17:298270-298292 TCTACCCCTGAGATTGGGGTCGG - Intronic
1142535676 17:616218-616240 CCTGGCACAAAGAATAGGGTAGG + Intronic
1146680737 17:34805970-34805992 TCACACACAGAGCATAGGGTTGG - Intergenic
1149969501 17:61202357-61202379 TCTATCACAGCGAATAAGGTTGG + Intronic
1155080916 18:22408842-22408864 TCTGCCACAGGGAACAGGGCAGG - Intergenic
1156576776 18:38326472-38326494 TCTACCACAGCTTAAAGGGTGGG - Intergenic
1158901059 18:61962154-61962176 TCTCCCACATTGAATAGGGCTGG + Intergenic
1160294107 18:77622243-77622265 TCTGCCACACAGAAAAGGGGAGG + Intergenic
1163071465 19:14845594-14845616 GCTACCACATTGAGTAGGGTTGG + Intergenic
1164507211 19:28870196-28870218 TTTCCCTCAGAGAAAAGGGTGGG - Intergenic
1167704077 19:51068081-51068103 TCCACCACAGAGAACCGGGCTGG + Intergenic
926827516 2:16921988-16922010 TCTAGCAGATAGAATAGAGTTGG + Intergenic
926966635 2:18421971-18421993 TCTATCAGATAGAATAGGTTTGG - Intergenic
927974096 2:27324859-27324881 TCTACCACTGAAAATAGGAAGGG + Intronic
927994134 2:27470811-27470833 TCTATCACAGAGATTAAGGGTGG + Intronic
928530066 2:32182043-32182065 GCTACCCCAGAGGCTAGGGTAGG - Intronic
935298158 2:101668669-101668691 TCTTCCACAGAAAATAGCCTGGG - Intergenic
935925716 2:108066066-108066088 TCAACCACAGAGACTGGGATTGG + Intergenic
937441993 2:121923695-121923717 TCTACCAGAGGGCAGAGGGTGGG - Intergenic
937457527 2:122055317-122055339 TGGAGCACATAGAATAGGGTAGG - Intergenic
939661218 2:144892396-144892418 TCTACCAAAGAGAATTTGCTAGG + Intergenic
939720848 2:145649148-145649170 TGTACCACAGGGACTAGGCTGGG - Intergenic
940490397 2:154351798-154351820 TCTATCACAAGGAATAGTGTAGG + Intronic
943562601 2:189482030-189482052 TTTACCCCAGAGAATAGGCTTGG + Intergenic
943761278 2:191612066-191612088 GCTACCTCAGAAAATAGGGAAGG - Intergenic
944434533 2:199672868-199672890 TCTACCAAACAGAAGAGGGTGGG - Intergenic
944528860 2:200648676-200648698 ACTACCAGAGTGAATAGGGAAGG + Intronic
945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG + Intergenic
945532661 2:210975368-210975390 TCCACCATAGAAAACAGGGTGGG + Intergenic
946948974 2:224851600-224851622 ACTACCACAGAGAATGGTGGGGG + Intronic
947068651 2:226260517-226260539 TATATGACAGAGAATAGGGTGGG + Intergenic
1171324007 20:24274859-24274881 GCATCCACAGAGAATAGGGAGGG + Intergenic
1171494188 20:25543599-25543621 TCTACCACGCAGAAAAGGTTGGG - Intronic
1171798213 20:29582779-29582801 TCTCCCACAGCCAACAGGGTAGG - Intergenic
1171850022 20:30301382-30301404 TCTCCCACAGCCAACAGGGTAGG + Intergenic
1171875249 20:30569470-30569492 TCTACTAAAGGGAATTGGGTGGG + Intergenic
1173270639 20:41531647-41531669 TCTACCACAGAAACTTGGGTGGG - Intronic
1179146732 21:38774739-38774761 TGTACCACAGAGCCTAGGATGGG - Intergenic
949330022 3:2911232-2911254 TGTACCACAGACACTAGGGGAGG + Intronic
949913851 3:8940893-8940915 GCAGTCACAGAGAATAGGGTGGG + Intronic
952308406 3:32165748-32165770 TTTACCTCAGAGAATAAGTTAGG - Intronic
953450821 3:43004479-43004501 TCTTCTACTGAGAAGAGGGTGGG - Intronic
954144266 3:48626617-48626639 CCTGCCACAGTGAGTAGGGTGGG - Exonic
954329962 3:49884576-49884598 GCTACCAGGGAGAACAGGGTAGG - Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955049008 3:55390521-55390543 TCTACAAGAGAGAAGAGAGTGGG + Intergenic
956756089 3:72388383-72388405 TCTGACGCAGAGAGTAGGGTTGG - Intronic
958746165 3:98137782-98137804 TTTACCACAGAGAAGTGGGAAGG + Intergenic
959261677 3:104090181-104090203 TAAACAACAGAGAACAGGGTTGG - Intergenic
960965675 3:123103104-123103126 ACTACCACAGAGATGAGGGGAGG - Intronic
961073200 3:123956644-123956666 TCTACCCCAGAAAATTAGGTAGG - Intronic
964174500 3:153809558-153809580 ACTACCAGAGAGAATAGATTTGG - Intergenic
964640969 3:158910243-158910265 TCTCCCACAGAGAGAAGTGTGGG + Intergenic
965309563 3:167112574-167112596 TCTACTATAGAGGATAAGGTAGG - Intergenic
965963774 3:174460742-174460764 TCAACAACAGAGAAATGGGTAGG - Intronic
967202519 3:187085015-187085037 TCAACAAAAGAGAGTAGGGTGGG + Intergenic
968257165 3:197286333-197286355 TTTTCCACAGAAAAGAGGGTGGG + Intronic
969396940 4:6928003-6928025 TTTTCCACAGAAGATAGGGTTGG + Intronic
969613133 4:8238008-8238030 TCTAACAAAGAAAACAGGGTAGG + Intronic
972557720 4:40197184-40197206 TCAACCACAGTGAAAAGGCTTGG + Exonic
972904736 4:43730895-43730917 TCTACCAGAGGGCACAGGGTGGG + Intergenic
974123414 4:57666635-57666657 TCTACCCCAGTGAAGAGAGTCGG - Intergenic
980169288 4:129268613-129268635 TCTGCCACAGAGAAAATGGCAGG + Intergenic
980807974 4:137837951-137837973 TCTGCCACAGAGAATGTGGCAGG - Intergenic
983710078 4:170704047-170704069 TCTACCTGAGAGCAGAGGGTAGG - Intergenic
986056943 5:4147521-4147543 TCAACCACAGAGGGGAGGGTGGG - Intergenic
987350241 5:17015787-17015809 AGTATCACAGAGAATAGGATTGG - Intergenic
989180200 5:38568792-38568814 TCTAGGACAGAGATTAGTGTGGG + Intronic
990139350 5:52684900-52684922 ACTCACACAGAGAATAGGATTGG - Intergenic
992248129 5:74849559-74849581 TCCAACACCGAGAATAGGTTAGG + Intronic
993525045 5:88954991-88955013 TCTTCTACAGAGAATAGCTTTGG - Intergenic
994143367 5:96366156-96366178 TCTACAAGACAGAAGAGGGTGGG - Intergenic
994722927 5:103401446-103401468 TCTTCTCCAGAGAATAGGGGTGG - Intergenic
995532708 5:113107084-113107106 TCTCCAACAGAGAATAGGGTAGG + Intronic
996075761 5:119191813-119191835 TACACCACAGAGATTGGGGTGGG + Intronic
996995847 5:129695975-129695997 TCTACCACAAAGAGTAGGTATGG + Intronic
998675547 5:144403883-144403905 TCTACCAAATAGAATGGGGGTGG - Intronic
999258815 5:150225310-150225332 TCTACCCCTGTGCATAGGGTGGG + Intronic
999446475 5:151644435-151644457 GCTACGACAGAGACTATGGTGGG - Intergenic
1001265252 5:170269401-170269423 TCTTCCACAGGGAAAAGGGTAGG + Intronic
1001913400 5:175539937-175539959 TCTCCCACAGGGACTAGGGATGG + Intergenic
1002410416 5:179070268-179070290 TCTTCCACAGACAGGAGGGTTGG - Intronic
1002818504 6:700369-700391 TCTACAACAGTGAATAAGGCAGG - Intergenic
1005436097 6:25813724-25813746 TCTACCACTGGGTAGAGGGTGGG - Intronic
1007341361 6:41193243-41193265 TCTGCTACAGAGGATAGAGTGGG - Intronic
1007407789 6:41644757-41644779 TCAATCACAGAGAATAGTGAGGG - Intronic
1011203806 6:84869233-84869255 TCTAGCACAGAGAAGAGTTTCGG - Intergenic
1018277223 6:162145996-162146018 TCTGCCACACAGAAAAGGTTGGG + Intronic
1018494203 6:164331668-164331690 TCTACCATAGAGATGTGGGTTGG - Intergenic
1021308679 7:19063998-19064020 TCTACCACCTAGAATAGAGTAGG + Intronic
1021422690 7:20463620-20463642 CCTACCAGAGAGGATAGGGAGGG - Intergenic
1023439429 7:40170874-40170896 TTGACCACAGAGAAAGGGGTTGG + Intronic
1025836742 7:65101394-65101416 TCTAACAAAGAAAATAGGCTGGG - Intergenic
1025906520 7:65790828-65790850 TCTAACAAAGAAAATAGGCTGGG - Intergenic
1026490347 7:70857639-70857661 GCAGCCACAGAGATTAGGGTGGG + Intergenic
1026895418 7:74007461-74007483 TCTATCAGAGAAAATAGGGCAGG + Intergenic
1027474353 7:78610645-78610667 TTTTCCAAAGAGAATATGGTAGG + Intronic
1028269595 7:88772428-88772450 TCTTCCACAGGGAATAGAGAAGG + Intronic
1028411032 7:90530583-90530605 TCTACACCAGGGAATAGGGAAGG - Intronic
1030120334 7:106104134-106104156 TCTACCACAGGGAATTGGGTAGG - Intronic
1032248393 7:130232248-130232270 TGTACCTCAGAGACTATGGTTGG - Intergenic
1032296126 7:130639971-130639993 CCTACCACTGAGAAAAGGGACGG - Intronic
1037532505 8:19791325-19791347 TCTGCCACAGAGAAAAGGGGTGG - Intergenic
1039122606 8:34165000-34165022 TCATACACAAAGAATAGGGTGGG - Intergenic
1045379860 8:101612355-101612377 TCTACAACAGTGAATACTGTTGG + Intronic
1046096171 8:109563858-109563880 TCTACCAAAGAGAAGAGTGGTGG - Intronic
1047112999 8:121811648-121811670 TCTCCGTCAGAGAGTAGGGTAGG - Intergenic
1049738305 8:144221786-144221808 GCTATCTCAGAGAACAGGGTGGG - Intronic
1050933329 9:11359995-11360017 GCAATCACATAGAATAGGGTTGG + Intergenic
1051219074 9:14829803-14829825 TCTACCAAGTAGAATAGAGTTGG - Intronic
1052487921 9:29126914-29126936 TCTGCTACACAGAAAAGGGTGGG - Intergenic
1057719308 9:97519351-97519373 TCTGCCACAGAGAAGCGGGGTGG + Intronic
1058193406 9:101945314-101945336 CCTACCAGAGAGTAAAGGGTGGG + Intergenic
1060885382 9:127148680-127148702 ACTACCCCAGAGAGTAGGGAGGG + Intronic
1189300693 X:39950112-39950134 TCTGCCACAGTCAATAGGGAGGG - Intergenic
1192686955 X:73317346-73317368 TCTACCAAAGAGTGAAGGGTGGG - Intergenic
1197316840 X:124977019-124977041 GCTACCATAGAGAGTAGGGTTGG + Intergenic
1197772141 X:130095961-130095983 TCTACCACAGAGAATAGGGTGGG - Intronic
1198526756 X:137509199-137509221 GCTACCAGAGAGGATAGGGAAGG + Intergenic
1198694296 X:139319535-139319557 ACTTCCACAGGGACTAGGGTGGG - Intergenic
1199033078 X:143023754-143023776 CATACCACATAAAATAGGGTAGG - Intergenic
1199685492 X:150261462-150261484 TCTCCTACAGAAAATAGGCTGGG - Intergenic
1199827064 X:151510884-151510906 TCTCCCACAATGAATAGGCTAGG + Intergenic