ID: 1197773813

View in Genome Browser
Species Human (GRCh38)
Location X:130107354-130107376
Sequence CTGTGTGTGGGGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3149
Summary {0: 1, 1: 6, 2: 32, 3: 509, 4: 2601}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197773797_1197773813 23 Left 1197773797 X:130107308-130107330 CCAGTGTTCCTTTCCCTCTCATT 0: 2
1: 0
2: 3
3: 64
4: 651
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601
1197773800_1197773813 9 Left 1197773800 X:130107322-130107344 CCTCTCATTCACCCAAATCCTAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601
1197773798_1197773813 15 Left 1197773798 X:130107316-130107338 CCTTTCCCTCTCATTCACCCAAA 0: 1
1: 0
2: 2
3: 66
4: 521
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601
1197773805_1197773813 -9 Left 1197773805 X:130107340-130107362 CCTAGGGCAAGACTCTGTGTGTG 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601
1197773804_1197773813 -3 Left 1197773804 X:130107334-130107356 CCAAATCCTAGGGCAAGACTCTG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601
1197773803_1197773813 -2 Left 1197773803 X:130107333-130107355 CCCAAATCCTAGGGCAAGACTCT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601
1197773799_1197773813 10 Left 1197773799 X:130107321-130107343 CCCTCTCATTCACCCAAATCCTA 0: 1
1: 0
2: 0
3: 22
4: 255
Right 1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG 0: 1
1: 6
2: 32
3: 509
4: 2601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197773813 Original CRISPR CTGTGTGTGGGGAGGGTGGG AGG Intronic
Too many off-targets to display for this crispr