ID: 1197778053

View in Genome Browser
Species Human (GRCh38)
Location X:130132996-130133018
Sequence CGGCCTCTGACCTATTTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197778048_1197778053 -4 Left 1197778048 X:130132977-130132999 CCTCGTGATCCGCCCACCTCGGC 0: 3607
1: 25565
2: 50007
3: 65946
4: 53864
Right 1197778053 X:130132996-130133018 CGGCCTCTGACCTATTTTGCCGG 0: 1
1: 0
2: 0
3: 1
4: 49
1197778044_1197778053 28 Left 1197778044 X:130132945-130132967 CCATGTTGGTCAGGCTGGTCTCA 0: 10762
1: 62831
2: 126315
3: 163705
4: 162399
Right 1197778053 X:130132996-130133018 CGGCCTCTGACCTATTTTGCCGG 0: 1
1: 0
2: 0
3: 1
4: 49
1197778046_1197778053 1 Left 1197778046 X:130132972-130132994 CCTGGCCTCGTGATCCGCCCACC 0: 53
1: 6321
2: 36345
3: 59976
4: 61468
Right 1197778053 X:130132996-130133018 CGGCCTCTGACCTATTTTGCCGG 0: 1
1: 0
2: 0
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197778053 Original CRISPR CGGCCTCTGACCTATTTTGC CGG Intronic
902860246 1:19240052-19240074 CAACCTCTGCCCTACTTTGCCGG + Intronic
908350921 1:63286059-63286081 CAGCCTCTGACCCATCTTCCAGG + Intergenic
915862811 1:159465172-159465194 CTGCCTTTGACCTTTTCTGCAGG + Intergenic
922034820 1:221838229-221838251 CTGCCTCTCACATATATTGCAGG - Intergenic
1079459497 11:20668064-20668086 TGGTCTCTGCCCTATTTTTCTGG - Intergenic
1081498508 11:43640713-43640735 CTGCCACTGACATATTTTGGGGG - Intronic
1084153281 11:67301136-67301158 CAGCCTCTCACCAATTTTGACGG - Exonic
1091586376 12:1819295-1819317 CCGCCTCTGACCTCTCATGCTGG - Intronic
1114580035 14:23748810-23748832 TTGCATCTGACCTATTCTGCAGG + Intergenic
1117505726 14:56401130-56401152 AGGCCCCTGACCTATTAAGCTGG + Intergenic
1120328243 14:83055534-83055556 AGGCCTCTGACATCTTTTGCCGG - Intergenic
1121440525 14:93946142-93946164 CAGCATCTGACCCTTTTTGCTGG - Intronic
1125857353 15:42962910-42962932 CATCCTCTGCCCTATGTTGCAGG - Intronic
1126362430 15:47860181-47860203 AGGCCTCTGAACTATACTGCTGG + Intergenic
1126872495 15:53004653-53004675 CAGCCACTGATCTAGTTTGCTGG - Intergenic
1129172662 15:73817553-73817575 TGGCCTTGGAGCTATTTTGCTGG - Intergenic
1131993608 15:98113577-98113599 ATGCTTCTGACCTTTTTTGCAGG - Intergenic
1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG + Intergenic
1134367705 16:13594730-13594752 CAGCTTCTGAGCTATTTTGTGGG - Intergenic
1142965426 17:3577820-3577842 CGGCCTGTGACCTTTTGTTCTGG - Intronic
1151299139 17:73209521-73209543 CGGCCTCTGACATGATGTGCCGG - Exonic
1156909637 18:42395397-42395419 TGGCCTCAGATCTACTTTGCAGG - Intergenic
1157136643 18:45063352-45063374 GGGCTTCTGGCCTCTTTTGCTGG - Exonic
931764076 2:65439114-65439136 CAGTCTCTGACCTATTGTGTGGG - Intergenic
937724208 2:125141162-125141184 CATCCACTGACCTATTTTCCTGG - Intergenic
947226690 2:227847460-227847482 TGGCCTCTGACCTGCTTTGGGGG - Intergenic
1168810267 20:700268-700290 CGGCCTCTGACCTTTCTCCCAGG - Intergenic
1182684362 22:32110029-32110051 GAGCCTATGACCTATTTTGTGGG + Exonic
1185122959 22:48984058-48984080 CTGCTTCTGGCCTTTTTTGCTGG - Intergenic
953660019 3:44885041-44885063 CGTGCACTTACCTATTTTGCGGG + Intronic
962267588 3:133954836-133954858 AGGCCTCTGAACTCATTTGCTGG + Intronic
966592804 3:181700391-181700413 CGGCGTCTTAACTATTTTGGTGG + Intergenic
984840977 4:184067119-184067141 TGGCCTCTGACCTGTATGGCTGG + Intergenic
986177496 5:5364594-5364616 CGGCCAGTGACCTATTGTCCTGG - Intergenic
991633030 5:68675678-68675700 TGGCCCCTGACCTATTTTATGGG - Intergenic
994661123 5:102655703-102655725 CGGCATTTGCCTTATTTTGCAGG + Intergenic
1002570253 5:180136077-180136099 TGGCCTCTGACCTACTAGGCGGG - Intronic
1002599357 5:180345512-180345534 GCGCCTCTGACCCATTCTGCAGG + Intronic
1004539835 6:16539348-16539370 AGGCCTCTGAGCTAGTTGGCTGG - Intronic
1012554499 6:100495149-100495171 CTGACTCTCACCTAATTTGCGGG + Intergenic
1032607004 7:133366680-133366702 AGGCCTCTCTCCCATTTTGCTGG + Intronic
1034621849 7:152463228-152463250 CGCCCTCTGCCTTGTTTTGCTGG + Intergenic
1035247613 7:157574266-157574288 CGACCTCTGACCTTGCTTGCTGG - Intronic
1037897625 8:22668793-22668815 CCGCGTCTGACCCGTTTTGCCGG - Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1190687589 X:52888392-52888414 AGGCCTCTGACCAATTTGGAGGG + Intergenic
1190698393 X:52967400-52967422 AGGCCTCTGACCAATTTGGAGGG - Intronic
1196257707 X:113541315-113541337 AAGCCTCTGAACTATATTGCAGG + Intergenic
1197778053 X:130132996-130133018 CGGCCTCTGACCTATTTTGCCGG + Intronic
1197811406 X:130447177-130447199 CAGCTGCTGACCTATTTTTCTGG - Intergenic
1198535632 X:137583192-137583214 TGGCCTCTGACATTTTTTGTTGG + Intergenic