ID: 1197781245

View in Genome Browser
Species Human (GRCh38)
Location X:130162662-130162684
Sequence CTCCTTGTGGGCAAGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197781245_1197781250 7 Left 1197781245 X:130162662-130162684 CCAGGATCCTTGCCCACAAGGAG 0: 1
1: 0
2: 4
3: 23
4: 177
Right 1197781250 X:130162692-130162714 TCCTTTTTAAAGAGGTGAGAAGG 0: 1
1: 0
2: 1
3: 30
4: 370
1197781245_1197781249 -1 Left 1197781245 X:130162662-130162684 CCAGGATCCTTGCCCACAAGGAG 0: 1
1: 0
2: 4
3: 23
4: 177
Right 1197781249 X:130162684-130162706 GCTCAGTTTCCTTTTTAAAGAGG 0: 1
1: 0
2: 11
3: 119
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197781245 Original CRISPR CTCCTTGTGGGCAAGGATCC TGG (reversed) Intronic
902113749 1:14104233-14104255 CTCCTTGCGGGGAAGGAGCAGGG - Intergenic
903054743 1:20627854-20627876 CTCCTGGTGGGCAAGGACTGTGG - Intergenic
903566060 1:24266647-24266669 CTCCTTGTGGTCAAGAATCAGGG - Intergenic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
905890007 1:41513009-41513031 CTCCTGGTGGGCGAGTATCTGGG + Exonic
906240542 1:44239672-44239694 CCCCCTGTGGGCAGGAATCCTGG + Intronic
907371552 1:54006772-54006794 CTCCTCGTGTGCTAGGATCCAGG + Intergenic
907508536 1:54940974-54940996 CTCCTTAAGGGCAGGGATCCTGG - Intergenic
907866371 1:58403169-58403191 CTCAGTATGGGCAAGGATCAGGG - Intronic
907932932 1:59016953-59016975 CCCTTTGAGGGCTAGGATCCAGG + Intergenic
909326918 1:74363189-74363211 CTCCTTGTGGCCAAGTGTCCAGG + Intronic
909513559 1:76482497-76482519 CTCCCTGTGGGCAAGGCACTGGG + Intronic
912245992 1:107962882-107962904 TTCCTTTAGGGCAAGTATCCTGG + Intronic
912554843 1:110508468-110508490 TTCCTGGTGGGCAGGGCTCCCGG - Intergenic
914808031 1:151006084-151006106 CTCCTTGTGAGCAAGTATACAGG - Exonic
919843909 1:201629035-201629057 CATCCTGAGGGCAAGGATCCTGG + Intronic
921613352 1:217237633-217237655 CTCCTTGGGGACAAAGGTCCAGG + Intergenic
1066363592 10:34754927-34754949 GTCCTTGTGGTCAAGGATGTAGG - Intronic
1067157222 10:43792352-43792374 CTCTTTGGGGGCAAGGACACTGG + Intergenic
1067466245 10:46501481-46501503 CTCCTTTAGGGCAAGAACCCAGG - Intergenic
1067620943 10:47883124-47883146 CTCCTTTAGGGCAAGAACCCAGG + Intergenic
1068663327 10:59646781-59646803 CTCCTGGTGGGCATGCCTCCAGG - Intergenic
1072608750 10:97003154-97003176 TTTCTTCTGGGCAAGGAGCCTGG - Intronic
1073947234 10:108765324-108765346 CTCCTTATAGGGAAGGAACCTGG - Intergenic
1076606590 10:131693543-131693565 TTCCCTGTGGGCAGGGCTCCTGG - Intergenic
1076606838 10:131694853-131694875 CTCCTTCTGGGGAAGGATTAGGG - Intergenic
1077488574 11:2850201-2850223 CTCCCTGTGGGCCAGGGTCCCGG - Intergenic
1078006793 11:7538200-7538222 CTCCTTGTGGGCTGGGCTCGTGG + Intronic
1078142840 11:8704116-8704138 CTCCTTGAAGGCAGGGATGCAGG - Intronic
1078617958 11:12882407-12882429 CGCCTTGTGGGGAAGGAGACAGG - Intronic
1080266444 11:30406764-30406786 TTGCTTGTGGGGAAGGTTCCAGG - Intronic
1083713795 11:64564385-64564407 CTCCTTGTGGCCATTTATCCTGG - Exonic
1085330266 11:75643408-75643430 CTCCTTGACAGCAGGGATCCTGG + Intronic
1089676292 11:120092228-120092250 CTCCATGAGGGCAAGGATTTTGG - Intergenic
1090158357 11:124465268-124465290 CTCCTTGTGGGAAATGATAATGG + Intergenic
1090260938 11:125319574-125319596 CTCCATGTGGACAAGAGTCCAGG - Intronic
1091083237 11:132693068-132693090 ATCCTTCTGGGCAAAGAGCCAGG - Intronic
1091640018 12:2229475-2229497 CTCCCCGTGGGCAGGGATTCAGG - Intronic
1091791195 12:3273211-3273233 CTCCTTGAGGGCCAGGATTTGGG - Intronic
1092099205 12:5869373-5869395 CTCCATGGGGACAAGGATCCAGG + Intronic
1092893332 12:12989926-12989948 CTCCTTGGGGGACTGGATCCAGG + Intronic
1093745135 12:22731658-22731680 CCCCTTGAGGCAAAGGATCCTGG - Intergenic
1099143345 12:79007978-79008000 TTCCTTGAGGGCAGTGATCCTGG - Intronic
1099956159 12:89353860-89353882 CTCCTTGGGAGCGAGGAGCCAGG - Intergenic
1103920557 12:124397077-124397099 CTGTTTGTGGGCAAGGAGCCAGG - Intronic
1104558540 12:129823591-129823613 CTCCTTCTGTGCAAGGGCCCAGG + Intronic
1104881625 12:132075303-132075325 CTCCATGTGGCCAGCGATCCCGG + Intronic
1105790920 13:23797994-23798016 CTCCATGAGAGCAAGGATTCTGG + Intronic
1111541159 13:89668978-89669000 CTTCTTGTGGGCTAAGATCAAGG - Intergenic
1118761902 14:68885246-68885268 CTCCTGGTGGGGAAGGAGCCCGG - Intronic
1120293832 14:82612867-82612889 CTCCTAGTGGCCAAGGTTCCTGG - Intergenic
1121493920 14:94378950-94378972 CTCCTTGAGGACACGGACCCTGG + Intronic
1121734706 14:96210167-96210189 CTGCTTGAAGGCAAAGATCCTGG + Intronic
1122111026 14:99502735-99502757 TTCCTTGTGAGTAAAGATCCAGG - Exonic
1122856470 14:104562618-104562640 CTCCATGTGGGCTAGGATCCGGG + Intronic
1122893891 14:104745833-104745855 CTCCCAGAGGGCAGGGATCCCGG - Intronic
1123810188 15:23916920-23916942 ATCCTTGTGAGCAAGGACTCTGG - Intergenic
1126499756 15:49332411-49332433 CTCATTGTGAGCAGGGATCCAGG + Intronic
1126666436 15:51079397-51079419 CTCCTTGAGGGCAGGGACCAAGG + Intronic
1126789803 15:52210694-52210716 ATCCCTGTAAGCAAGGATCCAGG + Intronic
1128061678 15:64739381-64739403 CCCCTTCTGGGCAAGATTCCAGG + Intergenic
1128326778 15:66729157-66729179 CTCCGTGTGGGCAGAGGTCCTGG - Intronic
1128515715 15:68340680-68340702 CTCCTTGAGGGAAAGTTTCCAGG + Intronic
1128788052 15:70412773-70412795 CTCCTTATGGGAAAGGGGCCAGG - Intergenic
1129018822 15:72495438-72495460 CTTCTTTTGGTCAAGGATCATGG + Intronic
1129882296 15:79015451-79015473 CTCCTGGTGGGCCTGGGTCCAGG - Intronic
1129988693 15:79942100-79942122 CACCTTGTGGGCTAGGACCAAGG + Intergenic
1130935287 15:88464963-88464985 CTCTTTGAGGGCAAGGATTGTGG - Intronic
1130991792 15:88880008-88880030 CTCCGTGTGGCCAAGGACCCAGG + Intronic
1131668132 15:94591683-94591705 CTCCTTGAGGGCAGGGATGATGG + Intergenic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1134996241 16:18741000-18741022 CTCCTTGAGGTCAAGGACCATGG + Intergenic
1135803458 16:25520551-25520573 CTCCATAGGGGCAAGGATCATGG + Intergenic
1136317283 16:29461730-29461752 TTCCTTGAGGTCAATGATCCAGG + Exonic
1136431858 16:30201073-30201095 TTCCTTGAGGTCAATGATCCAGG + Exonic
1138585825 16:57969980-57970002 GGGCTTGGGGGCAAGGATCCTGG - Intronic
1139141216 16:64264790-64264812 CTCCTGGTGGGCATGCATGCAGG + Intergenic
1139900120 16:70321573-70321595 CTCCTTGTGGGCAGGAATTTTGG - Intronic
1143273691 17:5694313-5694335 CTGCTTGTAGAAAAGGATCCTGG + Intergenic
1143757871 17:9079837-9079859 CTCCTTGGGGGCCAGGAAACAGG - Intronic
1143972220 17:10803954-10803976 CTCCTCCTGGGCAATGCTCCTGG - Intergenic
1145973254 17:28969386-28969408 CTCCTTGAGGACAAGGACCTTGG + Intronic
1151354680 17:73551316-73551338 CTCCTGGTGGGCAAGGTCTCTGG - Intronic
1151581410 17:74981412-74981434 CTCCTTGAGGGCAGGGACTCTGG - Intergenic
1152124433 17:78437904-78437926 CTCCTCGTGGGCCAGGAGCTGGG - Intronic
1152985031 18:313403-313425 CTTTTTGTGGGCAAGGGACCTGG + Intergenic
1155439926 18:25851656-25851678 CTCCTTGAGGGCAGGGACCATGG + Intergenic
1156474527 18:37397365-37397387 CTCCTGGGGGGCAGGGATCATGG - Intronic
1157963143 18:52179243-52179265 CACCTTGGGGGCAAGGGTGCAGG + Intergenic
1160506888 18:79432350-79432372 CTCCGTGTGGGCAGAGACCCAGG - Intronic
1160680745 19:410821-410843 CCCCTGCTGGGCACGGATCCTGG + Intergenic
1160680845 19:411080-411102 CCCCTGCTGGGCACGGATCCTGG + Intergenic
1161458173 19:4380382-4380404 CTCCTTGCGGGGAGGGAGCCAGG + Intronic
1162798944 19:13100773-13100795 TGCCTTGTGGGCAAGGACCCTGG + Intronic
1162819430 19:13213524-13213546 CTCCCTGAGGGCAGGGATTCTGG + Intronic
1163326683 19:16608043-16608065 GCCCTGGTGGGCAAGGCTCCAGG + Intronic
1164889112 19:31807834-31807856 TTGCTTCTGGGGAAGGATCCAGG + Intergenic
1166916047 19:46196687-46196709 CTCCCTGTGCTCAAGGGTCCTGG - Intergenic
1168356594 19:55704042-55704064 CTCCGTGTGGGCGAGAAGCCTGG - Intronic
926325025 2:11778113-11778135 GTCCATGTGGGAAAGGCTCCTGG - Intronic
927653424 2:24926496-24926518 CTCCTTGGGAGCAAGGACCAGGG + Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
928272238 2:29866836-29866858 AGCCTTGTGGGCAAGGCTCCTGG + Intronic
929123248 2:38500659-38500681 TTCCTTGTGAGCAGGGACCCTGG - Intergenic
929995718 2:46825266-46825288 CTCCTTGGAGGAAAGGGTCCAGG + Intronic
931720110 2:65061453-65061475 CTCCCGGTGCCCAAGGATCCTGG + Intronic
932116387 2:69053447-69053469 CTTCTTGTGCTCTAGGATCCCGG + Intronic
934980223 2:98833369-98833391 CGCCTTGTGGGCAAACATGCAGG + Intronic
935753075 2:106256099-106256121 CTCCTTGTGATGAAGGCTCCAGG + Intergenic
935913497 2:107923632-107923654 CTCCTTGTGATGAAGGCTCCAGG + Intergenic
936008149 2:108908157-108908179 CACCTTGTGGGCACGGGACCAGG + Intronic
939117449 2:138076731-138076753 CTCCCTATGGACAAGGATCTTGG - Intergenic
940325835 2:152424010-152424032 CTCCTAGTGTGCTAGGATTCTGG + Intronic
941225502 2:162841969-162841991 CTACTTATAGGCAAGGATGCAGG + Intergenic
943097508 2:183448158-183448180 TTCCTAGTGGGCAAGTATTCTGG + Intergenic
943482382 2:188436135-188436157 CACCAGGTGGGCAAGGATCTTGG + Intronic
945288593 2:208106599-208106621 CTCCTTGAGGCCAACGATCTGGG - Intergenic
946425530 2:219593592-219593614 TCCCCTGTAGGCAAGGATCCTGG + Intergenic
946434672 2:219643765-219643787 CTCCTTGCGGGCCCGGATGCAGG + Intergenic
946705515 2:222455011-222455033 CTCCTTGAAGGCAAGGACGCTGG - Intronic
948321789 2:237075843-237075865 CTCCTTGTGGCCAGGAGTCCTGG - Intergenic
1168834656 20:870002-870024 CTTCTTGTGAGGAAAGATCCTGG + Exonic
1170122434 20:12925654-12925676 CTCCTAGGGGTCACGGATCCTGG - Intergenic
1171197611 20:23212630-23212652 CTCCTGGTGTGGAAGGAGCCAGG - Intergenic
1171956372 20:31466921-31466943 CTCCTTGAGGGCAGGGACCATGG - Intronic
1174169692 20:48608329-48608351 CTCCTTAGGGCCAGGGATCCTGG - Intergenic
1175519445 20:59590616-59590638 CTCCTTGAGGCCACAGATCCAGG - Intronic
1176069263 20:63217570-63217592 CTCCATGTGGGCCACCATCCTGG - Intergenic
1179951010 21:44708832-44708854 CTCCGTGTGGGCAGGGGCCCTGG + Intronic
1180033396 21:45228026-45228048 CTACTGGTGGGCCAGGTTCCTGG - Intergenic
1181616754 22:24060241-24060263 CTACTTGTGGGCCTGGAACCTGG + Intronic
1182396805 22:30041981-30042003 CTCCATAAGGACAAGGATCCTGG - Intergenic
1182710960 22:32323119-32323141 CTCCTGGTGGGGGAGAATCCCGG - Intergenic
1182787959 22:32923477-32923499 CTCCTTGTGAGCAAGACTTCGGG + Intronic
1183505131 22:38204523-38204545 CTCTTAGAGGGCAGGGATCCAGG - Intronic
1184480872 22:44746120-44746142 CCCTTTATGGGCCAGGATCCTGG - Intronic
949159994 3:870076-870098 CACCTTGCATGCAAGGATCCTGG - Intergenic
950424916 3:12919914-12919936 CTCCCTGAGGGCAGGGAGCCGGG + Intronic
950710468 3:14810178-14810200 CTCCATGAGGGCAAGAATCTGGG + Intergenic
952418191 3:33108385-33108407 CTCCTGGTGTGGAATGATCCAGG + Intergenic
954092364 3:48295199-48295221 ATCCTTGTGGGCAAGGATGTAGG + Exonic
955218419 3:57004033-57004055 CTCCTTGAGGGCAAGGACTGGGG - Intronic
956712661 3:72051877-72051899 TTCCTTCTTGGCAAGGATCCAGG - Intergenic
959015785 3:101132494-101132516 CTCCTTCTGGGCAAAGACCATGG + Intergenic
960225717 3:115165804-115165826 CTCCTTTTGGGGAAGAATCTTGG + Intergenic
960944314 3:122955955-122955977 CTCCTTGAAGGCAAGGACCATGG - Intronic
962933383 3:140058179-140058201 CCCCTTGAGGGCAGGGATACTGG - Intronic
963598374 3:147356594-147356616 CTCTGTGTGGTCAAGAATCCTGG - Intergenic
964353866 3:155831073-155831095 CTCCTTGAGGGCAGGGATTTGGG + Intronic
964982813 3:162707165-162707187 CTACTTGTGAGAAAGGATCATGG - Intergenic
968690259 4:1986544-1986566 CTCCTTGAGGTCCGGGATCCTGG - Intronic
975366737 4:73538339-73538361 TTTCTTGTGGGCAGGGAGCCTGG + Intergenic
977061026 4:92256925-92256947 CTCCCTGTGGGCTAGAATACTGG + Intergenic
978587840 4:110292646-110292668 CTCCTGGTGGGGAAGCATACTGG + Intergenic
982326082 4:154129282-154129304 GGCCTTGTGGGGAAGGACCCTGG + Intergenic
993879067 5:93341910-93341932 TTCCTTTTGGGCAAGGATGTGGG - Intergenic
997616944 5:135253118-135253140 CTCCTTGAGGGCAAGGATGGTGG - Intronic
999124654 5:149238317-149238339 GTCCTGGTGGGCAGGGACCCAGG + Intronic
999392780 5:151206274-151206296 CTCCTTGGGGGCTACCATCCAGG + Intronic
999805924 5:155081297-155081319 CTCCTGGTGGGAAAGGATTTTGG + Intergenic
1000651281 5:163821912-163821934 CTCCTTGTGGGCAGGGGTGGTGG - Intergenic
1001419629 5:171576854-171576876 CTCCTTGAGGGCAGGGATGATGG + Intergenic
1001567814 5:172711885-172711907 GGCCTTGTGGACAAGGATTCTGG - Intergenic
1004339368 6:14794797-14794819 GTCCCTGTGGGCAAAGATCCTGG - Intergenic
1010028292 6:71245265-71245287 CTCCATGAGGGCAGGGATCATGG + Intergenic
1013481337 6:110555410-110555432 CTCCTTCTGTCCCAGGATCCTGG - Intergenic
1013610277 6:111788228-111788250 GTCCTTGAGGGCAAGAATGCAGG + Intronic
1015491994 6:133837185-133837207 CTCCTTTTGGGTAGAGATCCCGG - Intergenic
1018804669 6:167249469-167249491 CTCTCTGTGGGCAATGATCTGGG + Intergenic
1018825975 6:167408187-167408209 CTCTCTGTGGGCAATGATCTGGG + Intergenic
1019040081 6:169096486-169096508 CTCCTCCTGGGTGAGGATCCAGG + Intergenic
1019333895 7:473630-473652 CTCCCTGCAGCCAAGGATCCTGG + Intergenic
1023601576 7:41886300-41886322 CTCTGTGGGGGCCAGGATCCAGG - Intergenic
1024005070 7:45219405-45219427 CTCCTTGTGGGCACCGGCCCGGG + Intergenic
1026176037 7:67997911-67997933 ATCCTGGTGTGCAAGAATCCAGG - Intergenic
1027256906 7:76436735-76436757 CTCCTTAGGGGAGAGGATCCTGG + Intronic
1027281941 7:76615292-76615314 CTCCTTAGGGGAGAGGATCCTGG - Intronic
1028523076 7:91753192-91753214 CCCCTTGGGGGCAGAGATCCTGG + Intronic
1031098891 7:117454032-117454054 CTCATTGTTGACAAGGTTCCAGG + Intergenic
1031647728 7:124247093-124247115 CTCCTTGAGGGCAAGGACAATGG + Intergenic
1035043772 7:155950884-155950906 GTCCTTGTGGGGAAGGAGCTGGG + Intergenic
1038192257 8:25333839-25333861 CTCCCTGAGGCCAAGGATGCTGG + Intronic
1042805443 8:72766044-72766066 CTCATTGTGCACAAGCATCCAGG - Intronic
1043866704 8:85383101-85383123 CTCCTTGTGGGGCAGGGTGCAGG - Intronic
1046155393 8:110283071-110283093 CTCCTTGGGTGCAAGGATTATGG + Intergenic
1049316531 8:141971823-141971845 CTCCTGGCTGGCAAGAATCCTGG - Intergenic
1050608837 9:7330408-7330430 CTCCTTTTGGACCAGGTTCCTGG - Intergenic
1052385479 9:27818769-27818791 CTTCTTGTGGGGAAGAATCAAGG - Intergenic
1054858769 9:69928604-69928626 CCCCTTGCGGGGAGGGATCCAGG - Intergenic
1056383599 9:86077579-86077601 CTCCTTGTAGACACGGATCATGG - Exonic
1057465304 9:95308588-95308610 GTCCTGGTGGTCAAGGATGCAGG - Intronic
1058811639 9:108645172-108645194 CTCCTTGAGAGCAAGGATTCAGG + Intergenic
1058946498 9:109862027-109862049 CTCCTTGAGGACAAGGATCTTGG - Intronic
1061193597 9:129095703-129095725 CCCCTTGTGGGCAGGGATCATGG + Intronic
1061632189 9:131879379-131879401 CTTCTTGTGGGCAAGAAAACAGG + Intronic
1190582527 X:51902969-51902991 CTCCTAGAGGGACAGGATCCTGG - Intergenic
1195217735 X:102716459-102716481 CTCCTTCTGGGCTAAGTTCCAGG - Exonic
1197781245 X:130162662-130162684 CTCCTTGTGGGCAAGGATCCTGG - Intronic
1198312579 X:135436401-135436423 CTCCTAGAGGGCAAGGAGGCTGG + Intergenic
1198530381 X:137546252-137546274 CTCCTTGGGGTCGAGGATCCAGG - Intergenic
1199807835 X:151318428-151318450 CTTCTTTTGGGGAAGGACCCAGG - Intergenic
1200857102 Y:7950691-7950713 CTCCTGGTGGGCAGGACTCCTGG + Intergenic
1202261190 Y:22972191-22972213 CTCCTTGTGGGCAAGACTCCTGG - Intergenic
1202414178 Y:24605932-24605954 CTCCTTGTGGGCAAGACTCCTGG - Intergenic
1202456607 Y:25064154-25064176 CTCCTTGTGGGCAAGACTCCTGG + Intergenic