ID: 1197782487

View in Genome Browser
Species Human (GRCh38)
Location X:130171887-130171909
Sequence TGCGCGCGCGCGCGTGAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197782487_1197782496 7 Left 1197782487 X:130171887-130171909 CCCCCTTCACGCGCGCGCGCGCA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 1197782496 X:130171917-130171939 CCGGCGCACGCACACACGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 86
1197782487_1197782494 4 Left 1197782487 X:130171887-130171909 CCCCCTTCACGCGCGCGCGCGCA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 1197782494 X:130171914-130171936 GTGCCGGCGCACGCACACACGGG 0: 1
1: 0
2: 1
3: 8
4: 85
1197782487_1197782493 3 Left 1197782487 X:130171887-130171909 CCCCCTTCACGCGCGCGCGCGCA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 1197782493 X:130171913-130171935 GGTGCCGGCGCACGCACACACGG 0: 1
1: 0
2: 1
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197782487 Original CRISPR TGCGCGCGCGCGCGTGAAGG GGG (reversed) Exonic