ID: 1197782642

View in Genome Browser
Species Human (GRCh38)
Location X:130172607-130172629
Sequence AGGTGCCGCTGCTCGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197782642_1197782658 23 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782658 X:130172653-130172675 ATCTGTGGGTCCTAGTCTCTGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1197782642_1197782652 -4 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG 0: 1
1: 2
2: 9
3: 72
4: 736
1197782642_1197782655 8 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782655 X:130172638-130172660 AGGGAGGCAGGAGGCATCTGTGG 0: 1
1: 0
2: 8
3: 68
4: 686
1197782642_1197782657 22 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782657 X:130172652-130172674 CATCTGTGGGTCCTAGTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 116
1197782642_1197782656 9 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782656 X:130172639-130172661 GGGAGGCAGGAGGCATCTGTGGG 0: 1
1: 0
2: 5
3: 50
4: 480
1197782642_1197782659 27 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782659 X:130172657-130172679 GTGGGTCCTAGTCTCTGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 220
1197782642_1197782651 -8 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782651 X:130172622-130172644 CGGCACCTGTGGGCAGAGGGAGG 0: 1
1: 0
2: 4
3: 37
4: 315
1197782642_1197782654 -1 Left 1197782642 X:130172607-130172629 CCCTACCCCGAGCAGCGGCACCT 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1197782654 X:130172629-130172651 TGTGGGCAGAGGGAGGCAGGAGG 0: 1
1: 0
2: 31
3: 238
4: 1623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197782642 Original CRISPR AGGTGCCGCTGCTCGGGGTA GGG (reversed) Intronic
900399586 1:2467518-2467540 GGGTGCCCCTGCTCGGGCTGGGG + Intronic
900552502 1:3263829-3263851 AGGTGGCGCAGGTGGGGGTATGG + Intronic
900930677 1:5735062-5735084 AGTTGCATCGGCTCGGGGTAAGG + Intergenic
902272456 1:15314546-15314568 CGGTGACCCTGCTCGGGGGACGG - Intronic
902933281 1:19746126-19746148 AGGTGATGCTGCTCAGGGAAGGG + Intronic
912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG + Exonic
918257860 1:182766239-182766261 AGATGCTGGTGCTGGGGGTAGGG - Intergenic
923306082 1:232690053-232690075 AAGTGCTGCTGCTCAGGGTTTGG - Intergenic
923879109 1:238084160-238084182 AGGTGATTCTGCTCTGGGTAGGG + Intergenic
1063040316 10:2331421-2331443 TGATGCCGATGTTCGGGGTATGG - Intergenic
1071963758 10:90832314-90832336 AGCTGCCTCTCCTCGGGGCAGGG - Intronic
1082763479 11:57148432-57148454 GGGTGCCTGTGCTGGGGGTATGG - Intergenic
1083642723 11:64154043-64154065 AGGGGCCGCTGCATGGGGTGTGG - Intronic
1086415453 11:86585028-86585050 AAGTGGTGGTGCTCGGGGTAGGG + Intronic
1091226051 11:133956941-133956963 AGGTGCCGCTGCGCCGGGGCCGG - Exonic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1095547329 12:43387680-43387702 AGATTCCTCTGCTCTGGGTAGGG - Intronic
1095819675 12:46463778-46463800 AGGTACCCCTGCTGGGGGCATGG - Intergenic
1095945130 12:47749369-47749391 AGGTGCTGCTGCTGGGGTTGGGG - Exonic
1096812760 12:54182285-54182307 AGGTGCAGCTGCTGGGGGTGCGG - Exonic
1097777545 12:63666474-63666496 AGGAGACACTGCTCTGGGTATGG + Intronic
1099710842 12:86223067-86223089 AGGTGCACCTGCTCAGGGTTCGG - Intronic
1104728609 12:131093031-131093053 AGGGGCAGCTGCTTGTGGTACGG - Intronic
1105432710 13:20351828-20351850 AGGTGCCTGTGCTGGGGGTGAGG - Intergenic
1109630129 13:65034454-65034476 ACCTGCCGCTGCACGGGGGAGGG - Intergenic
1109858830 13:68171142-68171164 AGGTGCCTCCGCGCGGGGCAGGG + Intergenic
1113018390 13:105855053-105855075 AGGAGTCGCTGGTCTGGGTATGG - Intergenic
1113850949 13:113417602-113417624 AGCAGCCGCTGCTCGGGGTGTGG + Intergenic
1122266174 14:100547900-100547922 AGATGCCTCTGCTCGGGGCTGGG - Intronic
1124361544 15:29040137-29040159 AGGTGCTACTGCTCTGGGTCTGG - Intronic
1125698688 15:41660857-41660879 GGGTGCCGCTCCGCGTGGTACGG + Intronic
1126968482 15:54083402-54083424 GGGTGCTGCTGCTCTGTGTAGGG + Intronic
1129200918 15:73998760-73998782 AAGTGCCACTGCTGGGTGTAGGG + Intronic
1132698556 16:1212566-1212588 TGCGGCCGCTGCTCGGGGAAGGG + Intronic
1137442533 16:48508913-48508935 AGCTGCCTCTCCTCGGGGCAGGG + Intergenic
1141111810 16:81276215-81276237 AGGGGCCCCTGCTCTGGGTTTGG + Intronic
1144458044 17:15434916-15434938 AGGTCCCACCGCTCTGGGTATGG - Intergenic
1147017695 17:37505738-37505760 AGGTACCACTGCTCCAGGTATGG + Intronic
1147652030 17:42068199-42068221 AGCTGCCGATGCTCAGGGCAGGG - Intergenic
1147948206 17:44092375-44092397 AGGTGCCGGGCCTGGGGGTAAGG - Exonic
1150219334 17:63487261-63487283 AGGGGCAGCTGATCGGGGCATGG - Intronic
1151319159 17:73342406-73342428 AGGTGCCCCCGCTCGGCATATGG - Intronic
1151345472 17:73498817-73498839 AAGTGCCACTGCCCGGGGGAAGG + Intronic
1152484131 17:80578686-80578708 AGGTGCTGCTGCTAGGGCTGGGG + Intronic
1153075506 18:1157479-1157501 AGCTGCCACTGCTGGGGGTGGGG - Intergenic
1157687034 18:49650953-49650975 AGGTGCGGCGGCTGGGGGTTCGG + Intergenic
1160043327 18:75365319-75365341 AGGTGCAGCTATTAGGGGTACGG - Intergenic
1163182902 19:15616672-15616694 AGATGCCCCTGCACGGGGGAGGG - Intronic
1163371891 19:16905776-16905798 CAGTGCAGCTGCTGGGGGTAGGG + Intronic
1168236992 19:55069688-55069710 AGGTGCGGCTGCTTCAGGTAGGG - Intronic
1168343854 19:55641167-55641189 AGAGGCCGCCGCACGGGGTACGG + Intronic
926085795 2:10019704-10019726 AGTGGCTGCTTCTCGGGGTACGG + Intergenic
927594872 2:24387440-24387462 AGGTGTCGCTGGTCTGGGTGGGG + Intergenic
942022400 2:171879743-171879765 AGGTGCTGCTCCTAGGGGGATGG + Intronic
948060619 2:235041182-235041204 AGCTGGAGCTGCTCGGGGGATGG + Exonic
949018750 2:241728607-241728629 AGGTGCTGCTGCTGGGGACATGG + Exonic
1173594151 20:44247870-44247892 AGGTGCTGCTGCTGCGGGGAGGG + Intronic
1176423212 21:6532716-6532738 AGGTGCAGCTGCTCCAGGTGTGG + Intergenic
1179698705 21:43141032-43141054 AGGTGCAGCTGCTCCAGGTGTGG + Intergenic
1180243059 21:46524671-46524693 AGGTGCAGCTGCTCTGCCTAGGG - Intronic
1181928229 22:26377571-26377593 AGGTGCCGCTGCTCAGGAAGTGG + Intronic
1183400224 22:37599293-37599315 AGTTGCAGCTGCTGGGGGGAGGG - Intergenic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
1184820758 22:46907800-46907822 AGGAGCTGCTGCTTTGGGTAGGG + Intronic
1185018036 22:48357063-48357085 AGATGCCCCTGCTCAGGGGAGGG + Intergenic
954674742 3:52309528-52309550 AGGTGAAGCTGGTCGGGGAAAGG - Intergenic
958847065 3:99278064-99278086 TCATGCAGCTGCTCGGGGTAAGG - Intergenic
961506846 3:127375746-127375768 ATGTGCAGATGCTGGGGGTAGGG - Intergenic
962383745 3:134916497-134916519 AGCTGCCTCTGCACGGGGCAAGG - Intronic
965464050 3:169004883-169004905 AGGTGCCACTGCTCCTAGTATGG + Intergenic
967883159 3:194315687-194315709 AGGTGCCGATGCACGGGGGCGGG + Intergenic
968114796 3:196081567-196081589 AGGTGCAGCTGCGCGGCGTGCGG - Intronic
968453558 4:686362-686384 AGGTCCAGGTGCTCGGGGGACGG - Intronic
988636251 5:32987997-32988019 AAGTGCCGGGGCTAGGGGTAGGG - Intergenic
998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1003121226 6:3320363-3320385 AGGGGCGGCTTCTTGGGGTAGGG - Intronic
1005809050 6:29502447-29502469 AGGTACCTCTGTTCGGGGCATGG - Intergenic
1019013254 6:168860430-168860452 AGATGCGGCTGCTTGGGGCAAGG - Intergenic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020097751 7:5377951-5377973 AGGAACGGCTGCTCGGGGCACGG - Exonic
1022793592 7:33714296-33714318 TGGTGCCGCTGCTGGGTGTGGGG - Intergenic
1024090408 7:45935066-45935088 AGGTGCCTCAGCTCTGGGTCAGG + Intergenic
1029560527 7:101300005-101300027 AGCTGCAGCTGCTCAGGGCAGGG - Intergenic
1029561059 7:101303171-101303193 AGCTGCAGCTGCTCAGGGCAGGG - Intergenic
1029561940 7:101308701-101308723 AGCTGCAGCTGCTCAGGGCAAGG - Intergenic
1037819375 8:22128373-22128395 AGATGGAGCTGCTCAGGGTAGGG + Intronic
1037963308 8:23115794-23115816 AGGGGCTGCTGCAGGGGGTAGGG - Intronic
1037967708 8:23146763-23146785 AGGGGCTGCTGCAGGGGGTAGGG + Intronic
1039441063 8:37595602-37595624 AGGTGCCCCTGCTAGGGATCGGG + Intergenic
1039896918 8:41723456-41723478 AGGGCCCGCTGCTCTGGGTGAGG + Intronic
1048572030 8:135664451-135664473 AGCAGCTGCTGCTCGGGGTGTGG + Intergenic
1049376776 8:142293115-142293137 CGGTGCGGCTGCTCGAGGGAGGG - Intronic
1060820945 9:126661414-126661436 TGGGGCAGCTGCTCTGGGTATGG + Intronic
1060889227 9:127177621-127177643 GGCTCCCGCTGCTAGGGGTAGGG + Intronic
1060916758 9:127396710-127396732 AGGTGCAGCTTCTCGGAGTTGGG + Intergenic
1061921223 9:133783584-133783606 AGGTGCCCCTGCACAGGGGAGGG + Exonic
1194666300 X:96681234-96681256 AGGAGCCACTGCTCTCGGTAAGG - Intergenic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic
1200137630 X:153882756-153882778 AGCTGCCCCTGCTGGGTGTAAGG + Intronic