ID: 1197783621

View in Genome Browser
Species Human (GRCh38)
Location X:130179534-130179556
Sequence GAGGTCAGTAGGAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197783621_1197783623 -9 Left 1197783621 X:130179534-130179556 CCTGCTGTCTTCCTACTGACCTC 0: 1
1: 1
2: 3
3: 33
4: 258
Right 1197783623 X:130179548-130179570 ACTGACCTCCATTCCTCCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 177
1197783621_1197783631 27 Left 1197783621 X:130179534-130179556 CCTGCTGTCTTCCTACTGACCTC 0: 1
1: 1
2: 3
3: 33
4: 258
Right 1197783631 X:130179584-130179606 TCTTCCTGTTCGGAACACCACGG 0: 1
1: 0
2: 0
3: 6
4: 102
1197783621_1197783628 17 Left 1197783621 X:130179534-130179556 CCTGCTGTCTTCCTACTGACCTC 0: 1
1: 1
2: 3
3: 33
4: 258
Right 1197783628 X:130179574-130179596 GCTCTCCCTTTCTTCCTGTTCGG 0: 1
1: 0
2: 1
3: 35
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197783621 Original CRISPR GAGGTCAGTAGGAAGACAGC AGG (reversed) Intronic
902156860 1:14494651-14494673 GAGGTCAGAAGTAAGGCAGTGGG - Intergenic
902342928 1:15796129-15796151 GAGGGGAGGAGGAAGACAGGAGG + Intergenic
902378617 1:16042154-16042176 GGGCTCAGTAGAGAGACAGCAGG - Intergenic
902420924 1:16279139-16279161 CATGTCAGTAGGAAGACCACAGG - Intronic
903182360 1:21611407-21611429 GAGGACAGGTGGAAGACAGGAGG + Intronic
904266205 1:29319794-29319816 TAGGTCAGGAGGAAGACTGGGGG + Intronic
904848948 1:33442440-33442462 TATGTCAGTCTGAAGACAGCAGG + Intergenic
904876367 1:33657635-33657657 CAGGTCAGAAGGAGGACAGTGGG - Intronic
904984137 1:34530648-34530670 GAGGTCAGTGTGAGGACAGTAGG + Intergenic
906790465 1:48654641-48654663 GATGGCAGGAGGAAGGCAGCAGG + Intronic
907734088 1:57094810-57094832 CAGGCCAGTAGGAAGTCAGGAGG + Intronic
908010907 1:59776741-59776763 GAGGTCAAAGGCAAGACAGCTGG + Intergenic
910159636 1:84259342-84259364 GAGGTCAGTTGGGAGACTGGTGG + Intergenic
911171180 1:94772630-94772652 GAGGTCAGGAGTATGAGAGCAGG + Intergenic
911326454 1:96474653-96474675 GAGGGCGGTAGGAAACCAGCGGG + Intergenic
911728309 1:101265761-101265783 GAAGTCAGTTAGAGGACAGCTGG - Intergenic
912546517 1:110455288-110455310 GAGTCCAGGTGGAAGACAGCTGG - Intronic
913558889 1:119998001-119998023 GAGTTCACTAGGAAAACAGAAGG - Intronic
913638966 1:120792476-120792498 GAGTTCACTAGGAAAACAGAAGG + Intergenic
914279492 1:146157480-146157502 GAGTTCACTAGGAAAACAGAAGG - Intronic
914540532 1:148608410-148608432 GAGTTCACTAGGAAAACAGAAGG - Intronic
914626108 1:149462803-149462825 GAGTTCACTAGGAAAACAGACGG + Intergenic
915224231 1:154400660-154400682 GGGGTTAGTAGGAGGAGAGCGGG - Intergenic
915938452 1:160102972-160102994 GAGGTCAGAAGGGAGACCGAGGG - Intergenic
916495314 1:165341116-165341138 GTGGTTAGTAGGCAGCCAGCAGG - Intronic
916812682 1:168319297-168319319 GAGGTGAGTAGGAAGGAAGTGGG - Intergenic
917499307 1:175571678-175571700 GAGGTTAGTGGGGTGACAGCAGG - Intronic
920258857 1:204675217-204675239 GAGGTCAGAAGGAGGCCAACTGG + Intronic
921074983 1:211693371-211693393 GTGGGCAGTAGGAAGAAAGATGG - Intergenic
921794992 1:219332433-219332455 GAAGTCAGAAGCAACACAGCAGG - Intergenic
923067968 1:230537668-230537690 AAGGTCAACAGGAAGACTGCAGG - Intergenic
923617262 1:235548309-235548331 GAGGTCTGTAGGAAGATAGGTGG + Exonic
924598702 1:245469181-245469203 GAGTGCAGTAGGAAGACTCCAGG - Intronic
924942497 1:248821807-248821829 GAAGTTAGAAGGAAGTCAGCTGG - Intronic
1063434767 10:6020871-6020893 GATTTCAGAAGGAAGACAGCAGG + Intronic
1063965513 10:11343356-11343378 AATGTCAGTAGGAAGAGAACAGG - Intergenic
1067278162 10:44852309-44852331 GAGGAGAGGAGGAAGACAGCTGG + Intergenic
1067688313 10:48481133-48481155 GAGGTCGGTAGGAAGGAAGCTGG + Intronic
1067690140 10:48496681-48496703 AATATCTGTAGGAAGACAGCCGG + Intronic
1069128811 10:64672766-64672788 GAGGTCAGAATGAAAACTGCAGG - Intergenic
1069639351 10:69944901-69944923 GAGGACAGCAGGAAGTCAGGAGG + Intronic
1069713613 10:70506813-70506835 CAGGTCAGAAGGAAGACAGAGGG - Intronic
1070189513 10:74098874-74098896 GAGGTAACTAGGAAGACTGTAGG - Intronic
1071503541 10:86219616-86219638 GAGGGCAGGAGGGAGAGAGCTGG + Intronic
1073457279 10:103645276-103645298 GGGGCCGGCAGGAAGACAGCTGG - Intronic
1074140108 10:110664839-110664861 GAGGACAGGAGGAAGACAAAGGG - Intronic
1074253094 10:111773195-111773217 GAGGTGAATAGGAAGACAGGGGG + Intergenic
1074413836 10:113249872-113249894 GAGGTCAGTAGGAAATGATCGGG - Intergenic
1074572995 10:114641783-114641805 GAGATCAGGAGGCAGACAGCAGG + Intronic
1075294595 10:121263111-121263133 AAGGTCTGCAGGATGACAGCAGG + Intergenic
1076045089 10:127286031-127286053 GAGCCCAGTGGGAAGCCAGCTGG - Intronic
1076348195 10:129795066-129795088 CTGGGCAGTAGGAAGCCAGCAGG - Intergenic
1076484097 10:130804813-130804835 GAGGGGAGGAGGAAGACAGTAGG - Intergenic
1079126048 11:17719461-17719483 GAGGCCAATAGGAACACTGCGGG - Intergenic
1083369931 11:62170444-62170466 TTGGTCAGTAGGAAGTCATCAGG - Intergenic
1084780122 11:71402543-71402565 GGGGACAGTGGGGAGACAGCAGG + Intergenic
1085474177 11:76779278-76779300 GATGTCAGTACGAGGACCGCGGG - Intergenic
1087629300 11:100631699-100631721 GGGGTGAGTAGGAAGATGGCAGG + Intergenic
1089036548 11:115399856-115399878 TAGGTCAGTGGGTAGACCGCAGG - Intronic
1089643625 11:119863983-119864005 GAGGGCAGGAGGAAGGCAGGGGG - Intergenic
1089759607 11:120713419-120713441 GAGAGCAGGAGGAAGACAGAGGG + Intronic
1091421233 12:342673-342695 GAGGTCAGTAGTTAGAGACCAGG - Intronic
1096153001 12:49326127-49326149 GAGCTAAGAAGGGAGACAGCTGG + Exonic
1096355731 12:50939091-50939113 ATGGTGAGTAGGAAGACAGGAGG - Intergenic
1096820537 12:54230426-54230448 GAGGTCAGTTGGAAGTTAGGAGG - Intergenic
1097169122 12:57102680-57102702 GAGGTCAGAAGCACGAAAGCAGG + Intronic
1098617780 12:72551905-72551927 GAGGTCTGAAGGAAGAAAGACGG + Intronic
1098637412 12:72801502-72801524 GAGGTCAGTAAGAAGAAACCAGG - Intergenic
1099042951 12:77678823-77678845 GCGATCAGAAGGAAGACAGAAGG + Intergenic
1099298249 12:80858037-80858059 GAGCTCAGTAGGGAGGCATCAGG + Intronic
1100245930 12:92756989-92757011 GAGGTCAGTGGAAGGACAGGAGG + Intronic
1100452320 12:94719296-94719318 GGGGTTATTAGGAAGACAGAAGG + Intergenic
1100661236 12:96701417-96701439 TAGAGCAGTAGAAAGACAGCAGG + Intronic
1100708408 12:97227535-97227557 GGGTTTAGTAGGAAGATAGCTGG + Intergenic
1101131562 12:101696649-101696671 GAGGGCTGTAGGAAAACAGGTGG + Intergenic
1107834746 13:44404372-44404394 GAGGTCAGTAGGGAGCATGCAGG - Intergenic
1112177403 13:97040226-97040248 GAGGTGGGAAGGAAGACAGGAGG - Intergenic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1113710177 13:112457928-112457950 AGGGTCGGCAGGAAGACAGCAGG - Intergenic
1116950698 14:50875975-50875997 GAGCTTAGAAGGAAGCCAGCAGG + Intronic
1117727915 14:58692479-58692501 GGAGTCAGGAGGAAGACAGCTGG + Intergenic
1118885756 14:69864608-69864630 GAGGTGTGGAGGAAGGCAGCAGG + Intronic
1119513022 14:75226689-75226711 GAGGTGAGTGGGAAGAGAGAAGG + Intergenic
1119944637 14:78680215-78680237 GGGGCCTGTAGGAAGACAGAGGG + Intronic
1122413591 14:101538168-101538190 GAGGTGGGGAGGAAGACAGGAGG + Intergenic
1122935857 14:104955804-104955826 GAGCTCTGGAGGAAGCCAGCTGG + Intronic
1123813690 15:23955109-23955131 GAGGGCGGCAGGCAGACAGCAGG + Intergenic
1124216233 15:27808960-27808982 AAGGACAGAAGGAAGACAACAGG - Intronic
1124688011 15:31798778-31798800 GAGGCCAGAAGGAAGCCAGGGGG + Intronic
1127068983 15:55269531-55269553 GAGGTCAGGAGTTAGAAAGCAGG + Intronic
1127719584 15:61686631-61686653 GAAGTCCCTGGGAAGACAGCAGG - Intergenic
1128755607 15:70181621-70181643 GAGGCCAGAAAGAAGAGAGCAGG - Intergenic
1128931965 15:71713323-71713345 GAGCTCATTAGGAAAACAGCAGG - Intronic
1129098369 15:73233769-73233791 GATTTCAGTAGGAAAGCAGCTGG - Intronic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130017225 15:80196872-80196894 CAGCTCAGTAGGAAGAGAGCTGG - Intergenic
1131401122 15:92126338-92126360 CAGGTCACTAGGAACAAAGCTGG - Intronic
1131780947 15:95858082-95858104 GAGGAAAGTGGGTAGACAGCTGG + Intergenic
1132245804 15:100295336-100295358 GAGCTCAGCAGGAAGCCAGCTGG - Intronic
1132531746 16:454339-454361 GAGGTCAGTTGGAGGATTGCTGG + Intronic
1132872360 16:2121613-2121635 GAGGTGAGTAGACAGAGAGCTGG + Intronic
1133384196 16:5355588-5355610 GATGTAATTAGGAAGACAGAAGG + Intergenic
1133454617 16:5931259-5931281 GTGGTCAATAGGAACACAGGTGG - Intergenic
1136227740 16:28870351-28870373 GAGCTCAGGAGGAAGAGAGCAGG + Intronic
1138925123 16:61581466-61581488 GACGGCAGGAGGAAGACAACAGG - Intergenic
1138993660 16:62422084-62422106 GGGGTCAAGAGGAAGACAACTGG + Intergenic
1142686153 17:1578039-1578061 CAGGTCAGTGGGCAGACAGTTGG - Intronic
1143377009 17:6472830-6472852 GGGGTGAGTGGGAAGACAGAGGG + Intronic
1143844264 17:9760922-9760944 GGGGTCTGGAGGAAGACAGCTGG + Intergenic
1144891112 17:18494832-18494854 GAGGCCAGTGGGAAGCCATCAGG - Exonic
1145058399 17:19717523-19717545 GAGGGGGGCAGGAAGACAGCAGG + Intronic
1145404007 17:22570068-22570090 GAGAGCAGTAGGAGGGCAGCCGG - Intergenic
1145794815 17:27649447-27649469 GAGGCCAGTGGGAAGCCATCAGG - Exonic
1147118641 17:38321815-38321837 GAGGTCAGGAGTTGGACAGCTGG + Intronic
1147425817 17:40345424-40345446 GAGATCAGCAGGAAATCAGCCGG - Intronic
1147575125 17:41594586-41594608 GAGGACAGAAGGAGGACAGAGGG + Intergenic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1149318232 17:55458746-55458768 CAGGGCAGTGGGAGGACAGCCGG + Intergenic
1149491726 17:57089985-57090007 GAGATCTGTAGGAAGTCATCAGG - Intronic
1150461959 17:65360959-65360981 GAGGGCTCTGGGAAGACAGCAGG - Intergenic
1150579335 17:66457917-66457939 GAGGTCTGCAGGAGTACAGCAGG - Intronic
1152360539 17:79831321-79831343 GAGGTCAGAAGGCAGACAACGGG - Intergenic
1152936919 17:83144528-83144550 CAGCTCAGCAGGAAGGCAGCGGG + Intergenic
1153712922 18:7818472-7818494 GAGTCCAGTAGGAGGACACCAGG - Intronic
1156851760 18:41736930-41736952 GAGGACAGTTGGAAGGCAGGAGG + Intergenic
1157880301 18:51315013-51315035 GAGGTCAGCACGCACACAGCAGG - Intergenic
1160309605 18:77777236-77777258 CAAGCCAGGAGGAAGACAGCCGG - Intergenic
1160501815 18:79405264-79405286 CAGGTGAGCAGGGAGACAGCTGG - Intronic
1163347896 19:16755894-16755916 GAGGTACGTTGGGAGACAGCTGG - Intronic
1164806556 19:31121436-31121458 GAGGCCTGCAGGCAGACAGCAGG + Intergenic
1167080900 19:47275431-47275453 GATGTCATTAGGAAGAAGGCCGG - Exonic
1167888727 19:52522861-52522883 GAGGTCAAGAGGATGACAGCAGG - Intergenic
1167915840 19:52739649-52739671 GAGATCAAGAGGATGACAGCAGG + Intergenic
1168294293 19:55371085-55371107 GAGAGCGGGAGGAAGACAGCAGG + Intergenic
925580328 2:5403990-5404012 GAGGTCAGTAGGAAGAAACCAGG + Intergenic
925806772 2:7658620-7658642 CAGGCCAGTCGGAAGAAAGCTGG - Intergenic
926233981 2:11025693-11025715 AAGGTCAGAAGGGAGGCAGCAGG - Intergenic
927427165 2:22994390-22994412 GAGGTGAGTAGGGAGAGGGCAGG + Intergenic
929891532 2:45922549-45922571 GAAGATAGTAGGAAGAGAGCAGG - Intronic
932800723 2:74740344-74740366 TAGGGCTGTATGAAGACAGCAGG + Intergenic
933099499 2:78234780-78234802 GAGGACAGAAGGAAGATAGGAGG + Intergenic
933652068 2:84857721-84857743 GCCGTCAGAAGGAAGACATCGGG - Intronic
935346917 2:102116826-102116848 GAGGTCATAAAGAAGACACCAGG - Intronic
937690110 2:124745879-124745901 GAGGTAAGTAGGAAGAGACCAGG - Intronic
938115748 2:128602064-128602086 GAGATCAGTGGGCAGAAAGCCGG + Intergenic
940246166 2:151619086-151619108 GAGGGCAGTAGGGAGATAGAGGG - Intronic
941062484 2:160863835-160863857 TAGTTCAGTAGGAAGAGAGTGGG - Intergenic
941733832 2:168949947-168949969 GAGGGCAGGAAGAATACAGCAGG - Intronic
944159591 2:196644327-196644349 TAGGTCAGTAGCTGGACAGCAGG + Intronic
944820903 2:203429832-203429854 GCGGTCAGCAGGAATGCAGCTGG + Exonic
946159353 2:217826662-217826684 GAGGGAAGGAGGAAAACAGCAGG - Intronic
946230208 2:218286656-218286678 GGCCTCAGTAGGCAGACAGCAGG - Exonic
946611206 2:221459819-221459841 GAGGTCATTAGAAAGAAAGCAGG + Intronic
946750424 2:222889860-222889882 GAGGTGAGAGGGAAGACAACTGG + Intronic
947589256 2:231375844-231375866 GGGGTGAGAAAGAAGACAGCAGG + Intergenic
948477196 2:238227707-238227729 GGGGACAGCAGGAGGACAGCCGG - Exonic
948655999 2:239476930-239476952 GAGGTCAGCTGGGACACAGCCGG + Intergenic
1169143098 20:3237091-3237113 GACATGAGGAGGAAGACAGCTGG + Intronic
1169157080 20:3340806-3340828 TGGGTCAGTAGGGAGACAGCTGG - Intronic
1170342313 20:15342958-15342980 GAGGTCAGTAGCAAAACACAAGG - Intronic
1171183725 20:23110166-23110188 GAGCTCACTTGGAGGACAGCTGG - Intergenic
1174729323 20:52899397-52899419 CAGGTCAGAAGGAAGACAGATGG + Intergenic
1175061581 20:56248435-56248457 GGAGACAGAAGGAAGACAGCTGG + Intergenic
1175322451 20:58098781-58098803 GAGGCCCAGAGGAAGACAGCTGG - Intergenic
1175409000 20:58753739-58753761 GAGGTCTTTGGGATGACAGCAGG - Intergenic
1176001895 20:62835996-62836018 GAGGTGGGCAGGAAGCCAGCAGG - Intronic
1176370765 21:6060264-6060286 GGGGTCAGGAGGATGCCAGCAGG + Intergenic
1178105877 21:29318645-29318667 GAGGTGAGTAGTCAGCCAGCTGG + Intronic
1178376677 21:32073304-32073326 GAAGTCTGTGGGCAGACAGCAGG - Intergenic
1178425474 21:32475773-32475795 GAAGTCAGCTGGAAGTCAGCCGG - Intronic
1179752754 21:43478277-43478299 GGGGTCAGGAGGATGCCAGCAGG - Intergenic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1182256007 22:29039064-29039086 CAGGTCAGTAATAAGGCAGCTGG - Intronic
1182301589 22:29340177-29340199 GAGGGGAGTGGGAAGACAGTAGG - Intronic
1183058070 22:35319120-35319142 GAGGTCAGAAGAAAGAAAGCAGG + Intronic
1184792997 22:46712634-46712656 GAGGTGAGTGTGCAGACAGCAGG + Intronic
949346179 3:3078958-3078980 GAGGTCAGTAAAAATAAAGCTGG - Intronic
950139877 3:10608102-10608124 GGAGTCAGGAGGTAGACAGCAGG - Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
951045834 3:18037435-18037457 GAAGGCTGTAGGAAGGCAGCGGG + Intronic
953905192 3:46865106-46865128 GGGCCCAGTAGGAAGACAGCAGG - Intronic
954434937 3:50490949-50490971 GAGGTCAGTGGGACAACAGGTGG + Intronic
954955431 3:54514555-54514577 CAGGTCAGTGGGAAGGCAGGCGG + Intronic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
959841461 3:110981766-110981788 GAGGTAACTAGGAAAACAGTAGG - Intergenic
961662389 3:128476454-128476476 GACGTCAGTTGCAAGAGAGCAGG - Intergenic
962391248 3:134974681-134974703 GAGGCCATTAGGATGTCAGCTGG - Intronic
963221781 3:142820858-142820880 GAGGTGAGTAGGGAGAAAACTGG - Exonic
964186777 3:153955015-153955037 GAAGTGAGCAGGAAGACAGGAGG + Intergenic
965502101 3:169469317-169469339 CCTGTCAGTAGGAAGCCAGCAGG + Intronic
967942884 3:194779906-194779928 AAGGTCAGTGGGCAGACAGCAGG - Intergenic
968080018 3:195839589-195839611 GAGGGGAGGAGGGAGACAGCTGG - Intergenic
968153174 3:196355794-196355816 GTGATCTGTAGGAAGGCAGCTGG - Exonic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
971261685 4:25062994-25063016 GAGGGCAGTTGGAAAACGGCTGG + Intergenic
971699498 4:29952047-29952069 GAGGTCAGTAGGAAGAGTTGGGG + Intergenic
973039505 4:45452924-45452946 GAAGTCAGTGGGAAGAAAACGGG + Intergenic
975135821 4:70873423-70873445 GAGCGCAGTCCGAAGACAGCAGG - Intergenic
975286550 4:72628215-72628237 GAGTGCAATAGGAAGACAACAGG - Intergenic
976681495 4:87761090-87761112 GAGGTCAGAAGGGGGACACCTGG - Intergenic
977996817 4:103504718-103504740 GAGGTTAGAAGCAAGTCAGCAGG - Intergenic
978538345 4:109787075-109787097 TAGGTCAGTGGGGAGTCAGCTGG - Intronic
981014778 4:139962417-139962439 TAAGTCAGTAGATAGACAGCAGG + Intronic
981875121 4:149532941-149532963 GAGGTCAGTGGGAAGACAGCAGG + Intergenic
982240807 4:153297586-153297608 GAGATCAGTGGGGAGCCAGCAGG - Intronic
982581537 4:157185785-157185807 TAGGTGAGTAGGGAGACAACAGG - Intergenic
983238475 4:165206513-165206535 GAGGTCAGGAGGACGGCGGCAGG - Intronic
985347390 4:189020521-189020543 GAGGGATATAGGAAGACAGCAGG - Intergenic
986034435 5:3924558-3924580 CAGGTGTGCAGGAAGACAGCAGG + Intergenic
986307105 5:6524143-6524165 GAGGTCTGTGGGATGACACCAGG - Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
987322178 5:16780504-16780526 GAGGTGAGTGGGACGACAGCTGG - Exonic
988307963 5:29518295-29518317 GAGGACAGTAGGAAGGGACCTGG - Intergenic
990292124 5:54362925-54362947 GAGGTAAGATGGAAGACAGCAGG + Intergenic
990508027 5:56464170-56464192 GTGGTCAGGAGGCAGAAAGCAGG + Intronic
991006063 5:61829160-61829182 GAGGTCAGTAGTACAACAACAGG + Intergenic
992527553 5:77627982-77628004 GAGGTTAGTACGCAGCCAGCAGG + Intergenic
993537273 5:89102534-89102556 GTGGTCATGAGGAAGACTGCTGG + Intergenic
993969072 5:94394892-94394914 GAGGTCAGTATGATGAGACCAGG + Intronic
995215604 5:109591228-109591250 GAGGCCAGTATGTAGACTGCTGG + Intergenic
995566369 5:113435722-113435744 CAGCTCTGTAGGAGGACAGCTGG + Intronic
996603459 5:125293185-125293207 GAGTTCAATAGGAAGCCAGAGGG + Intergenic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
998741082 5:145202668-145202690 GAGGTAAGTAAGGAGAAAGCGGG - Intergenic
999452864 5:151691495-151691517 GAGGGCAGTGGGCAGGCAGCAGG - Intergenic
999486639 5:152003844-152003866 GAGGACAATATGAAGACATCAGG + Intergenic
1000395369 5:160769220-160769242 CAGGTGAGAAGGAAGAGAGCTGG - Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004655142 6:17652720-17652742 AAACTCAGTAAGAAGACAGCTGG + Intronic
1004712729 6:18187872-18187894 CAGGGTAGTAGGCAGACAGCAGG - Intronic
1005377771 6:25201789-25201811 GTATTCAGTAGGAAGACAGTGGG + Intergenic
1006471346 6:34230886-34230908 GAGGTCAGAGGGCAGACTGCAGG + Intergenic
1006801158 6:36760474-36760496 GAGGACAGAAGGAAGAAAGGAGG + Intronic
1006909460 6:37554805-37554827 GAGGTGGGGAGGAAGACAGGTGG + Intergenic
1007227906 6:40327850-40327872 GAGGTCAGGATGAACACAGAAGG + Intergenic
1007270189 6:40630442-40630464 GAGGTCTGTAGAGAGACAGAGGG + Intergenic
1008660170 6:53659676-53659698 GAGGTCATGAGGGAGACAGTTGG + Intronic
1008738698 6:54578574-54578596 GATGTCAGGGGGAATACAGCAGG + Intergenic
1009918128 6:70022484-70022506 CAGGTAGGTAGGTAGACAGCTGG + Intronic
1010654192 6:78492504-78492526 GAGGTCAGTTCGCAGGCAGCTGG + Intergenic
1011100575 6:83716215-83716237 GAGGTCAGTAGTTCGACACCAGG + Intergenic
1011718980 6:90135611-90135633 GAGCTGAGTAGGAGGACTGCTGG + Intronic
1013301246 6:108806647-108806669 GAGTTCAGAAGGAAGACATAAGG + Intergenic
1013429268 6:110041285-110041307 GAGATCACTGTGAAGACAGCTGG - Intergenic
1014302898 6:119705854-119705876 GAGGTCAGAAAGAAGAGAGATGG - Intergenic
1014416437 6:121190354-121190376 GAGGTGGGAAGGAAGACAGAGGG - Intronic
1017742493 6:157419144-157419166 AACCTCAGGAGGAAGACAGCAGG - Intronic
1018900257 6:168048360-168048382 AAGGTCAGAAGGAGGACGGCAGG - Intergenic
1021318574 7:19182454-19182476 GATGGCAGTAGTAAGACAGGTGG - Intergenic
1023228611 7:37999820-37999842 GAGTTCAATGGGAAGACAGTGGG + Intronic
1024058507 7:45681757-45681779 GAGGTTTGCAGGAAGCCAGCAGG + Intronic
1024897627 7:54279003-54279025 GGGGTCTGTAGGAAGACAGAGGG + Intergenic
1025078395 7:55962847-55962869 GAGGGCAGGAGGAAGGAAGCTGG - Intronic
1027629309 7:80582509-80582531 GGGGTTAGTAGGACTACAGCTGG + Intronic
1029217210 7:98959200-98959222 GAGGTCAGGCGGAAGAGAGGTGG + Intronic
1029549947 7:101232369-101232391 TGGGGCAGTGGGAAGACAGCGGG + Exonic
1031102766 7:117502685-117502707 GAGGCCAGTCTGAATACAGCAGG - Intronic
1031106739 7:117553053-117553075 GAACACAGCAGGAAGACAGCTGG + Intronic
1031356931 7:120798363-120798385 GAAGTCAGTAGAGAGACAGGAGG + Intronic
1033170433 7:139079115-139079137 GAGCTCACAAGGAAGACAACAGG - Intronic
1033249975 7:139750087-139750109 GAGGTCAGAAGCCAGACAGTTGG - Intronic
1033589704 7:142798824-142798846 GAGGTCACTGGGGAGACAGGGGG + Intergenic
1033716216 7:144005198-144005220 GAGTTAAGTAGGAAGAGAGATGG + Intergenic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1037224377 8:16567372-16567394 GAGGTAAGTAGGAATGCACCTGG - Intronic
1037675353 8:21046240-21046262 GAGCTCTTTGGGAAGACAGCAGG - Intergenic
1038317361 8:26498437-26498459 GAGGGAAGTAGGAAGTGAGCTGG - Intronic
1039575109 8:38616909-38616931 GAGGTCTGGAAGAAGACAGGTGG - Intergenic
1043185080 8:77138163-77138185 AAGGGCAGAAGGAAGACAGAGGG - Intergenic
1044905282 8:96994391-96994413 GTGGTCAGTAGGAAGATACTTGG + Intronic
1045391843 8:101723002-101723024 GTGGTGAGGAGGAAGACAGAGGG + Intronic
1046593153 8:116229452-116229474 CAGGTCTGTAGGAAGACGGCAGG + Intergenic
1047327733 8:123855592-123855614 GGGTCCAGTGGGAAGACAGCCGG - Intronic
1047346765 8:124036569-124036591 GAAGACAGTAGAAAGAAAGCAGG - Intronic
1047432619 8:124805827-124805849 GAATTCAGAAGGAAGACAGGAGG - Intergenic
1048502264 8:134988967-134988989 GAGACCTGTAGGAAGCCAGCAGG + Intergenic
1050435769 9:5608749-5608771 GTGGTCAGGAGGTAGAGAGCAGG + Intergenic
1053739371 9:41124122-41124144 GAGGCCAGGAGGAAGAAATCCGG + Intergenic
1054688980 9:68307200-68307222 GAGGCCAGGAGGAAGAAATCCGG - Intergenic
1054809665 9:69425054-69425076 GATGACGGTGGGAAGACAGCTGG - Intergenic
1055508438 9:76971146-76971168 GAGGTCTGTGGGAAGAGAACAGG - Intergenic
1055582117 9:77716918-77716940 GTGATCATTGGGAAGACAGCAGG + Exonic
1056175560 9:84031624-84031646 GTGGTCAGTTGGAAGAAGGCAGG + Intergenic
1058945495 9:109851736-109851758 GAAGTGAGTCAGAAGACAGCAGG - Intronic
1060054218 9:120399995-120400017 AAGGCCAGTAGGAAGGCAGAAGG - Intronic
1061351316 9:130067047-130067069 AAGGACAATAGGAAGAGAGCTGG + Intronic
1061851172 9:133416663-133416685 CAGGTCACTAGGGAGACAGCAGG + Intronic
1186200810 X:7153402-7153424 GAGGACAGGAGGAAGACAGGAGG - Intergenic
1186299810 X:8187939-8187961 GGGGTCAGTGGGAGAACAGCAGG + Intergenic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1191852761 X:65597979-65598001 AAGTTAAGGAGGAAGACAGCAGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194276650 X:91892863-91892885 GAGGTCAGGAGTTAGAGAGCAGG - Intronic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1197867255 X:131032493-131032515 GAGATCAGTAGGCAGACAGCTGG - Intergenic