ID: 1197783622

View in Genome Browser
Species Human (GRCh38)
Location X:130179545-130179567
Sequence CAGGAGGAATGGAGGTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197783622_1197783633 21 Left 1197783622 X:130179545-130179567 CCTACTGACCTCCATTCCTCCTG 0: 1
1: 0
2: 2
3: 31
4: 394
Right 1197783633 X:130179589-130179611 CTGTTCGGAACACCACGGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 26
1197783622_1197783631 16 Left 1197783622 X:130179545-130179567 CCTACTGACCTCCATTCCTCCTG 0: 1
1: 0
2: 2
3: 31
4: 394
Right 1197783631 X:130179584-130179606 TCTTCCTGTTCGGAACACCACGG 0: 1
1: 0
2: 0
3: 6
4: 102
1197783622_1197783634 24 Left 1197783622 X:130179545-130179567 CCTACTGACCTCCATTCCTCCTG 0: 1
1: 0
2: 2
3: 31
4: 394
Right 1197783634 X:130179592-130179614 TTCGGAACACCACGGAGAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1197783622_1197783628 6 Left 1197783622 X:130179545-130179567 CCTACTGACCTCCATTCCTCCTG 0: 1
1: 0
2: 2
3: 31
4: 394
Right 1197783628 X:130179574-130179596 GCTCTCCCTTTCTTCCTGTTCGG 0: 1
1: 0
2: 1
3: 35
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197783622 Original CRISPR CAGGAGGAATGGAGGTCAGT AGG (reversed) Intronic
900146037 1:1158990-1159012 CAGGATGAAAGCAGGGCAGTGGG + Intergenic
901882372 1:12201875-12201897 CAGGAGGTGTGGATGGCAGTGGG + Intronic
903240668 1:21980792-21980814 CAGGAGGAAAGGGCCTCAGTGGG - Intronic
903244411 1:22005415-22005437 CAGGAGGAAAGGGCCTCAGTGGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
904565386 1:31425424-31425446 CAGGAGGCATGGGGGGCTGTGGG + Intronic
904893975 1:33800293-33800315 GAGGAGGAGGGGAGGCCAGTAGG + Intronic
905294072 1:36943030-36943052 CAGGAGGGATGCTGGTGAGTGGG - Intronic
905537054 1:38730280-38730302 AAGGTGGATTGGAGGGCAGTGGG + Intergenic
906315437 1:44784156-44784178 CGGGAGGGAAGGAGGGCAGTGGG + Exonic
906474360 1:46158121-46158143 CAGCAGGAATGGGGGTGAGAAGG - Intronic
906998303 1:50822578-50822600 CAGAAGGAAGAGAGGTGAGTGGG - Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907408052 1:54265811-54265833 TAGGAGGAAGGGAGGTCGGCTGG - Intronic
909212171 1:72837938-72837960 CAGGAGCAATTGAGCTCAGTAGG + Intergenic
910361574 1:86417745-86417767 CAGGTGGAGTGGGGGCCAGTTGG - Intergenic
910599279 1:89013189-89013211 CAGGAGGCATCAAGGTCAATGGG - Exonic
912228793 1:107768028-107768050 GTGGAGGAATGGAGGAAAGTAGG + Intronic
912986280 1:114435612-114435634 CAAGAAGAATGGAGGACAGTAGG + Intronic
914247862 1:145899196-145899218 CAGGAGTACGGGAGGTCACTTGG + Exonic
916339143 1:163709170-163709192 CAGAAGCAGTGGAAGTCAGTAGG - Intergenic
916608796 1:166369620-166369642 AAGGAGGAAAGGAGGGCAGGAGG - Intergenic
918490453 1:185075658-185075680 CAGGAGGAAGAGAGAGCAGTGGG + Intronic
919883822 1:201918318-201918340 CAGGAGGCAGGGGGTTCAGTGGG - Intronic
919891465 1:201978476-201978498 CATGAGGAAAGGAACTCAGTCGG - Intergenic
920006241 1:202835736-202835758 AGGGAGGAAAAGAGGTCAGTGGG - Intergenic
920192701 1:204203658-204203680 CAGGAGGGAGGGAGGACAATGGG - Intronic
920341113 1:205275709-205275731 CAGGAGGAATGGAGATGACATGG + Intergenic
922033289 1:221825014-221825036 CAGGAGGTGTGGAGGTTTGTTGG + Intergenic
922797706 1:228349157-228349179 GAGGAGGCATGGAGGGCTGTGGG + Intronic
923332989 1:232942916-232942938 CAGGAGAAAAGGAGGCCTGTTGG - Intergenic
924480518 1:244428533-244428555 AGGGAGGGAGGGAGGTCAGTTGG + Intronic
1063282240 10:4642972-4642994 CAGGAGGAAAGGAGGACCTTAGG - Intergenic
1063651882 10:7946234-7946256 CAAGAGGAAAGGAGGTGGGTTGG - Intronic
1065992873 10:31030255-31030277 AAGGAAGAAAGGAGGACAGTGGG - Intronic
1067037665 10:42932105-42932127 CTGGAGGAAAGGTGGTCATTGGG + Intergenic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067469387 10:46524896-46524918 CAGAAAGAATGGGGGTGAGTGGG + Intergenic
1067479820 10:46587432-46587454 AGGGAGGAAAGGAGGTCACTGGG + Intronic
1067614917 10:47754365-47754387 AGGGAGGAAAGGAGGTCACTGGG - Intergenic
1067829168 10:49600243-49600265 CAGGAGGAATGGTGGTCACGTGG - Intergenic
1069772359 10:70907832-70907854 GTGGAGGAAGGGAGGTCGGTTGG + Intergenic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1071103597 10:82067986-82068008 GAGGAGGAATGTAAGTCAGAAGG - Intronic
1071364915 10:84889720-84889742 CAGGAGAAATGGAGGAAAATAGG + Intergenic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1071630322 10:87214329-87214351 AGGGAGGAAAGGAGGTCACTGGG - Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1072884382 10:99260841-99260863 AAGGAGGAATGGAGGTCGCAAGG - Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1075985169 10:126779048-126779070 GAGGAGGTGAGGAGGTCAGTGGG - Intergenic
1076526034 10:131112877-131112899 GAGGAGGGACGGGGGTCAGTAGG - Intronic
1076867324 10:133174429-133174451 CAGAAGGAAGGGCGGTGAGTGGG + Intronic
1077548069 11:3185083-3185105 CAGGAGGAAGAGAGGCCAGAGGG + Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1078470376 11:11581513-11581535 GAGGAGGAGGGGAGGTCAGCTGG - Intronic
1078813954 11:14800754-14800776 CAGGGGGAATGGAGCCAAGTTGG - Intronic
1079587896 11:22148934-22148956 CAGGAAGAATGGAGCCAAGTTGG - Intergenic
1079964394 11:26963197-26963219 AAGGAGGAAAGGAGGGCAGGAGG + Intergenic
1080136461 11:28860261-28860283 AAGGAGAAATGGATGCCAGTTGG + Intergenic
1081659268 11:44877953-44877975 CAGGAGATATGGTGGTGAGTGGG - Intronic
1081866045 11:46361352-46361374 CAGGTGGAAGGGAGGCCACTGGG + Intronic
1082008290 11:47433371-47433393 GAGGAGGAGTGGAGGCCAGGAGG - Intergenic
1082737608 11:56873936-56873958 CTGGAGGGGTGGAAGTCAGTGGG - Intergenic
1083187339 11:61025413-61025435 CTGGAGGAAGGGAGGCCAGCTGG + Intergenic
1083675636 11:64323278-64323300 GAGGATGCCTGGAGGTCAGTGGG + Intergenic
1084324949 11:68394868-68394890 CAGAAGGGACGGAGGTCAGGAGG + Intronic
1085770862 11:79324903-79324925 CAGGTGAAATGGAAGTCAGAAGG + Intronic
1089083537 11:115797758-115797780 CTGGAGGCAGGGAGGTCAGCTGG + Intergenic
1089384170 11:118057188-118057210 AAGGAGGAATAGAGTTCAGAAGG + Intergenic
1090288031 11:125517183-125517205 AAGGAGGAAAGGAGGGCAGCTGG - Intergenic
1090461933 11:126898924-126898946 AAGGAGGTTTGGAGGACAGTTGG - Intronic
1091357936 11:134952325-134952347 CCACAGGAAAGGAGGTCAGTGGG - Intergenic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091749563 12:3014035-3014057 CAGGAGGAATGGAACTGAGTGGG - Intronic
1091864053 12:3815001-3815023 CAGGAGGAAAGAAGGAGAGTAGG + Intronic
1091890645 12:4051549-4051571 CATGAGAAATGGAGGGCAATAGG - Intergenic
1092001941 12:5039916-5039938 CAGGTGTAATGGGGGTAAGTTGG + Intergenic
1093764153 12:22943009-22943031 CAGTTGGAACTGAGGTCAGTGGG + Intergenic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1098257071 12:68627338-68627360 CATGAGGAAAGGAACTCAGTTGG + Intronic
1098329697 12:69340479-69340501 CTGGAGGAATTGAGGTTAGGTGG - Intergenic
1099169716 12:79349108-79349130 CAGGAGGAAGGGAGGAAGGTAGG + Intronic
1101278538 12:103227130-103227152 AAGGAGGAATGGAGGTTGGAAGG + Intergenic
1101760082 12:107651251-107651273 AAGGAGGAAAGGAGGACAGATGG + Intronic
1103622353 12:122195573-122195595 CAGAAACAATGGAGGCCAGTAGG - Intronic
1103908614 12:124339951-124339973 CAGGTGGATGGGTGGTCAGTAGG - Intronic
1105831181 13:24164307-24164329 CAGGAGCAAGGGGGCTCAGTGGG - Intronic
1106017553 13:25884014-25884036 TAGGAGAAATGGAGTTCAGGGGG + Intronic
1106547522 13:30743511-30743533 GAGGGGGAATGGAGGGCACTGGG - Intronic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1106935852 13:34718654-34718676 TAGGAGGAAGGGAGGGCAGCAGG + Intergenic
1107677619 13:42813134-42813156 CAGGAGGAATAGAGAGCAGGAGG - Intergenic
1109536937 13:63734135-63734157 CAAGAGGAAGGTATGTCAGTAGG + Intergenic
1110449178 13:75621959-75621981 TAGGTGGAAAAGAGGTCAGTAGG + Intronic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1111859082 13:93678769-93678791 AAGGTGGAACGGAGCTCAGTGGG + Intronic
1112203495 13:97301523-97301545 AAGGAGGAAGGGAGGACAGCGGG + Intronic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1112296873 13:98195573-98195595 CACAAGGAAGGGAGGGCAGTGGG + Intronic
1113092015 13:106626496-106626518 CATGAGGAAGGGATGTCAGGTGG + Intergenic
1113924588 13:113934406-113934428 CAGGATGGATGGAGATGAGTCGG + Intergenic
1114909549 14:27173006-27173028 TAGTAGTAATGGAAGTCAGTAGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117643107 14:57821772-57821794 CAGGTGAAATGGAGGTCACCTGG - Intronic
1118138369 14:63052341-63052363 CAGGAAGAAGGGAGACCAGTTGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1120797307 14:88648683-88648705 CAGGAGGAAGGGAGGTTGGGAGG - Intronic
1121378778 14:93441730-93441752 CAGGAGGCATGGAGGGCATATGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1121786978 14:96669312-96669334 TAGAAAGAATGGAGGTCAGAGGG + Intergenic
1122268304 14:100556931-100556953 CAGGTTGGATGGAGATCAGTGGG - Intronic
1123608382 15:22061267-22061289 AAGGAGGAATGAACTTCAGTGGG + Intergenic
1123778418 15:23602784-23602806 CATGGGGTGTGGAGGTCAGTGGG - Intronic
1123811427 15:23930177-23930199 CATGGGGAATGGAGGTCAGTGGG + Intergenic
1123811672 15:23932737-23932759 CAGGAGGATTGGATCTCAGGAGG + Intergenic
1125951031 15:43751575-43751597 CAGCAGGAATGGAACTCAGGTGG - Intronic
1126803563 15:52322391-52322413 TGGGAGGCATGGAGGGCAGTTGG + Intronic
1127078811 15:55354527-55354549 AAGGAGGGAAGTAGGTCAGTAGG - Intronic
1129488672 15:75902873-75902895 CGGGAGGAATGGATGTTAGGTGG + Intergenic
1129676854 15:77636453-77636475 CAGGAGCCTTGGAGGTGAGTGGG + Intronic
1129743221 15:78000316-78000338 CAGGAGGAGCGGAGGTGAGTGGG - Intronic
1130847147 15:87758145-87758167 AAGGAGGAAAGGAGGACAGGAGG + Intergenic
1130956271 15:88629463-88629485 CAGGTGGCATGGAGGCCAGGCGG - Intronic
1130990273 15:88871894-88871916 GAGGAGGAAAGGAGGTGGGTGGG - Intronic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131950920 15:97681012-97681034 CAGGAGTAATAGAAGTAAGTGGG + Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132669592 16:1097134-1097156 GAGGAGGAAAGGAGGACAGGAGG + Intergenic
1133080160 16:3312263-3312285 CAGAAGGAATTGAGATCAGATGG + Intronic
1133419649 16:5635403-5635425 CATGAGGAATGGAGGCCACCAGG - Intergenic
1133850665 16:9500373-9500395 GAGGAGCACTGGAGGCCAGTAGG - Intergenic
1134197646 16:12171176-12171198 CAGGAATAATACAGGTCAGTAGG - Intronic
1135282757 16:21166993-21167015 CAGGAGGCAGTGAGGTCAGCGGG + Intronic
1136235297 16:28910198-28910220 CAGGAGGGTAGGAGGGCAGTAGG - Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138912917 16:61424566-61424588 GAGGGGGAATGGAGGTCTTTGGG - Intergenic
1139094989 16:63694617-63694639 GAGGAGGGAGGGAGGGCAGTAGG + Intergenic
1139650484 16:68359707-68359729 CACGAGGAGCGGAGGTCAGCGGG + Exonic
1139921249 16:70461760-70461782 AAGGAGGAAGGGAGGGCAGCAGG - Intronic
1140205877 16:72933079-72933101 CAGGTGGAGTGGGGCTCAGTGGG - Intronic
1141672380 16:85499047-85499069 CAGGAGGAGTTGAGGCCAGATGG + Intergenic
1142062489 16:88039689-88039711 CAGCAGGCATGGAGGCCCGTTGG + Intronic
1142957708 17:3532610-3532632 CAGGAGGTCGGGAGGTCAGGAGG - Intronic
1143858299 17:9869200-9869222 CTGGAGGAGGGGAGATCAGTTGG - Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144810364 17:17994910-17994932 CATGAGGAAGGCAGGTCAGGAGG - Intronic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146296661 17:31655394-31655416 CAATAGGAATGCCGGTCAGTAGG + Intergenic
1146919578 17:36701549-36701571 GAGGAGGAAGGGAGGAGAGTAGG - Intergenic
1146931896 17:36783534-36783556 TAGGAGGCAGGGAGGTAAGTGGG - Intergenic
1146950226 17:36900362-36900384 CAGGAGGTTTGGGGGACAGTGGG - Intergenic
1147266397 17:39237315-39237337 GAGGAGGGAGGGAGGGCAGTGGG + Intergenic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148949510 17:51298164-51298186 CTTGAGCTATGGAGGTCAGTCGG + Intergenic
1149656648 17:58312633-58312655 CTGGAGGGAGGGAGGTCAGGAGG + Exonic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1152032357 17:77851790-77851812 CAGGAGGAAAGCAGGACAGTGGG - Intergenic
1153945686 18:10015282-10015304 CAGGAGGAACGGAGGCAACTTGG - Intergenic
1153953427 18:10076233-10076255 CATGAGGAAAGGAGGTCATGGGG - Intergenic
1154496976 18:14968816-14968838 CCATAGGAAAGGAGGTCAGTGGG + Intergenic
1155365022 18:25041283-25041305 CAGGAGGAATGGAGATCCCTGGG - Intergenic
1156276927 18:35592693-35592715 GGGGAGGCATGGAGATCAGTTGG + Intronic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1156765020 18:40642303-40642325 TTGGAGGAATGGAGGTAGGTGGG - Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157488614 18:48107179-48107201 AGGGAGGAAGGGAGGTCAGGAGG + Intronic
1158636887 18:59166758-59166780 CAGGAGGAATCCAGGACAGAGGG + Intergenic
1160205143 18:76825244-76825266 CAGGAGGACTGGTGTTCAGAAGG - Intronic
1161285100 19:3464543-3464565 CCCTAGGCATGGAGGTCAGTTGG - Intronic
1161605628 19:5213285-5213307 CAGGAGCCATGGAGGGCTGTGGG - Intronic
1162136055 19:8555893-8555915 AAGGAGGAATGGAGGTGGGGCGG - Intronic
1162295549 19:9811044-9811066 CAGGAGGAGAGGATTTCAGTGGG + Exonic
1162312717 19:9916599-9916621 CAGGAGGCCTGGAGCCCAGTTGG - Intronic
1162541105 19:11296487-11296509 CAGGAGGGATGTAGGGCAGACGG + Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163410881 19:17153756-17153778 CTGGAGGATTGGAGGTGGGTGGG - Intronic
1163796110 19:19338947-19338969 CAGGAGGGAAGGAGGGGAGTGGG - Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164826421 19:31287871-31287893 CAGGAGGAAAGGAGGCCCGGAGG - Intronic
1166060257 19:40321436-40321458 GAGGAGTGAGGGAGGTCAGTGGG + Exonic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166118131 19:40667923-40667945 CAGGAGGCATGGTGGGCACTGGG + Exonic
1166690105 19:44817377-44817399 CAGGAGGAATGGGGAAGAGTGGG + Intronic
1168151516 19:54451393-54451415 CGAGAGGGATGGAGGCCAGTCGG + Intronic
1168403866 19:56100771-56100793 CAGGAGGAATGCACGTAAGCGGG + Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
925267296 2:2574941-2574963 CAGCAGGATTGGAGGCCAGCAGG - Intergenic
925459426 2:4047487-4047509 CAGGAGGCCAGGCGGTCAGTGGG - Intergenic
926688799 2:15718551-15718573 CAGGATGAAGGGAGGCCAGCAGG - Intronic
926917051 2:17902121-17902143 CAGAAGCAGAGGAGGTCAGTAGG + Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
927875567 2:26653172-26653194 CAGGAGGAAGGGTGGTCAGATGG - Intergenic
929304025 2:40339343-40339365 CAGGAGGAAAGGATATCAGAAGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929930464 2:46251652-46251674 GAGTAGGAAAGGAGGCCAGTTGG + Intergenic
932247564 2:70208206-70208228 CAGAGGGAATGGTGGCCAGTTGG + Intronic
932989662 2:76771439-76771461 AATGAGGAATGGAGGTGAGGTGG + Intronic
933368149 2:81381061-81381083 GAGGTGGAAGGGAGGTCAGATGG + Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934579195 2:95425000-95425022 CAGGAGCTGTGTAGGTCAGTGGG + Intergenic
934600251 2:95651724-95651746 CAGGAGCTGTGTAGGTCAGTGGG - Intergenic
934971237 2:98766194-98766216 GATGAGGAAGGGAGGACAGTGGG + Intergenic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
935092150 2:99905429-99905451 CAAGAGGAAGGGAGGGCAGAGGG - Intronic
936514481 2:113173261-113173283 CACGGGGAATGGAGGTCCCTTGG + Intronic
936533602 2:113293725-113293747 CAGGAGCTGTGTAGGTCAGTGGG - Intergenic
937108423 2:119341388-119341410 CAGGGTGATTGGAGGTGAGTGGG - Intronic
937263036 2:120598462-120598484 CAGGAGGAAAGCGGGCCAGTAGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938193883 2:129308997-129309019 TAGGAGAAATGGATGTCATTTGG + Intergenic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
939112356 2:138023696-138023718 CAGGAAGAATAGAGGTCTGCTGG + Intergenic
939168707 2:138668319-138668341 CAGGAGAAATGCATTTCAGTTGG + Intergenic
939463029 2:142522066-142522088 CAGGTGAAATGGAGGTAAATTGG - Intergenic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
943540347 2:189206058-189206080 CAGGAGTAAAGGAGCTAAGTAGG + Intergenic
943786401 2:191882350-191882372 CAGGAGTAAAGGAGTGCAGTTGG + Intergenic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
943995218 2:194754704-194754726 GAGGAGTAATAAAGGTCAGTAGG + Intergenic
944511611 2:200471448-200471470 CAGGAGGAAAGGAGGTGAAGGGG - Intronic
945064775 2:205939577-205939599 CCGGAGGGATGGAAGTCAGCGGG - Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945623756 2:212173749-212173771 CTGGATGAAAGGAGGTCAGAGGG + Intronic
946417150 2:219545722-219545744 CAGGAGAATTGTAGGTGAGTGGG + Intronic
948674919 2:239591617-239591639 CAGGAGGTGTGGACGGCAGTGGG + Intergenic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
949081068 2:242100195-242100217 CAGGATGAATGGATGTCTGAGGG + Intergenic
1168792907 20:591977-591999 CAGGAGGCAGGGAGGCCAGTTGG - Intergenic
1169229877 20:3880934-3880956 TAGGAGGAATGGTTGTAAGTTGG + Intergenic
1170592766 20:17783505-17783527 CAGGAGGAGTGGAGGTTGGGTGG - Intergenic
1173929155 20:46804089-46804111 AAGGAGGAAGGGAGGAAAGTCGG + Intergenic
1174736665 20:52972088-52972110 CGGGAGGAAAGGAGGTGAGGAGG - Intergenic
1174767200 20:53265432-53265454 AAGGAGGAAAGGAGGTCTGTTGG + Intronic
1175422094 20:58840939-58840961 CAGGTGGAAAGGAGGTGAGAAGG + Intronic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1175935273 20:62511115-62511137 CAGGAGGGGTGGAGGTCAGGAGG - Intergenic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1178036092 21:28584652-28584674 CTGGTGGAATGGTGATCAGTGGG + Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1179193788 21:39145666-39145688 GAGAAGGAAAGGAGGGCAGTAGG + Intergenic
1182041146 22:27239839-27239861 AAGGAGGCATGGAGGTCAACAGG - Intergenic
1182084169 22:27550158-27550180 CGGGAGGCAGGGAGGCCAGTGGG + Intergenic
1182356211 22:29723277-29723299 GGGGAGGCATGGAGGGCAGTTGG + Intronic
1182704783 22:32270324-32270346 CAGGAAGAATGGGGCTCTGTCGG + Intergenic
1184154442 22:42657916-42657938 CAGGGGGATGGGAGGACAGTGGG + Intergenic
1184281751 22:43441398-43441420 CAGGAGGAAGGGAGGCCAGTAGG - Intronic
1184900799 22:47445330-47445352 CAGGAGGATGGGCGGTCAGGAGG - Intergenic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
1185224654 22:49645563-49645585 AATGAGGGATGGAGGACAGTTGG + Intronic
1185413831 22:50699264-50699286 CAAGAGGAAATGAGGCCAGTTGG + Intergenic
950483570 3:13259691-13259713 CAGGAAGAAAGGAGGTTTGTGGG - Intergenic
950560824 3:13722350-13722372 CAGGAATAATGGAAGTCAGAAGG - Intergenic
950933312 3:16812514-16812536 CAGCAGGAATGGAGGTGGGTAGG + Intronic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
953403908 3:42650950-42650972 CTGGAGGCATTGAGGTCAGTGGG - Intergenic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954405235 3:50341748-50341770 CAGGAGGCATGGATGTGGGTGGG - Intronic
954918406 3:54168194-54168216 CTGGTGGAAATGAGGTCAGTGGG + Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
957071772 3:75572906-75572928 GAAGAGTAATGGAGGCCAGTTGG - Intergenic
957591692 3:82207455-82207477 CAGGAGGAAAGAGGGTCAGGAGG + Intergenic
959526340 3:107381676-107381698 CAGGAGGGATGGAGGTGGGCTGG - Intergenic
959636208 3:108574580-108574602 CAGGAGGAAAGGAGCACAATTGG - Intronic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960988223 3:123294224-123294246 CAGAAGGAATGGCGGACACTGGG + Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
961368818 3:126417536-126417558 CAGGGGGAATGGGGGTTAGACGG + Intronic
961411913 3:126728344-126728366 CAGGAGGAATGGTGGTGGGTGGG + Intronic
961987746 3:131155746-131155768 CAGGAGGTGTGCAGGACAGTGGG + Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
963590669 3:147254218-147254240 CAGGAGGAATTAAAGTCAGCAGG + Intergenic
963699271 3:148603776-148603798 CAGGAAGAATAGAGGTAATTAGG + Intergenic
963854236 3:150237709-150237731 CAGGAAGAATCTGGGTCAGTGGG + Intergenic
964719582 3:159757798-159757820 CAGGAGGCATGGAGGTAGCTTGG - Intronic
965077713 3:164001251-164001273 AAGAAGGAAAGGAGGTCAGAAGG + Intergenic
967099626 3:186205634-186205656 CAGGAGGAAGGGGTTTCAGTGGG + Intronic
967294084 3:187948563-187948585 CAGGAGGCATGGAGGTGACAGGG + Intergenic
968471218 4:783283-783305 CAGGAGGAAGGGGGGCCAGCTGG + Intergenic
968645980 4:1740708-1740730 CAGGAGGAGAGGTGGGCAGTGGG - Intronic
968856582 4:3128914-3128936 AAGGAGGAATAGAGTTCAATGGG - Intronic
969355170 4:6620870-6620892 CATGAGGAATTGAGGCCACTAGG + Intronic
969492544 4:7508226-7508248 GAGGAGGGATGAAGGTCAGGAGG + Intronic
970607251 4:17692225-17692247 CAGAAGGAAGGGAGGACAGCAGG + Intronic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
973274141 4:48291279-48291301 CAGGAGGAAAGGACGTGAGTTGG - Intergenic
973643046 4:52922058-52922080 CAGGAGGTAGGGAGGTGAGACGG - Intronic
974160559 4:58132802-58132824 CAGGAGTAATGGAGGTGAAAAGG + Intergenic
977062657 4:92275943-92275965 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
978417173 4:108488807-108488829 AAGGAGGAATGGAAGTGAGTGGG - Intergenic
979951143 4:126895796-126895818 AGAGAGGAATGGAGGTTAGTTGG + Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
981864505 4:149399415-149399437 CAGGAGGAAGGGAGGTTGGGAGG + Intergenic
982790471 4:159586079-159586101 CAGGAGGAAGGGAGCACAGAGGG + Intergenic
983464848 4:168074402-168074424 CAGGAGGCAGGGACGGCAGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985368726 4:189261870-189261892 CAGGAGGAATAGAGCAAAGTGGG + Intergenic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
986886887 5:12249667-12249689 CAGGAGGAATGAAGGCAACTGGG - Intergenic
987367025 5:17158026-17158048 CAAGAGGAATGAAGGACAGAGGG + Intronic
987452198 5:18099681-18099703 CAGGATGAACAGAGGTTAGTGGG + Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
992123266 5:73615797-73615819 CAGGAGGAAGGGACGTGAGATGG + Intergenic
992448154 5:76852173-76852195 CAAGTGGAGTGGAGGCCAGTGGG - Intronic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
993456631 5:88134493-88134515 CTGGAGGAATAAAAGTCAGTAGG + Intergenic
993583917 5:89699512-89699534 CAGGAGGAAGAGAGGTGTGTAGG - Intergenic
993835438 5:92814132-92814154 CATGAGGCATGGAGGCCATTTGG - Intergenic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
995253486 5:110019554-110019576 CATAAGGAAAAGAGGTCAGTGGG + Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1000567473 5:162867668-162867690 CAGGAGGAATGGTGGTGGGGAGG - Intergenic
1000950630 5:167477827-167477849 AAGGAGGAAAGGAGGGCAATAGG + Intronic
1000980162 5:167808331-167808353 CAGGAGGCAGAGAGTTCAGTGGG - Intronic
1001237327 5:170041426-170041448 CAGAAGGAATGCAGCTCAGTGGG - Intronic
1001389313 5:171366133-171366155 CATGAGGAAAGGAACTCAGTCGG - Intergenic
1001782715 5:174384230-174384252 GTGGTGGAAGGGAGGTCAGTGGG + Intergenic
1002210587 5:177596599-177596621 CAGCTGGAATGGAGGTGGGTGGG + Intergenic
1002337342 5:178489112-178489134 GAGATGGCATGGAGGTCAGTGGG + Intronic
1003354355 6:5352724-5352746 AAGGAGGAAGGGAGGACAGAAGG - Intronic
1003534317 6:6962912-6962934 CAGAAGGAAGGGAGGTGAGATGG - Intergenic
1003744709 6:8987528-8987550 CACCAGGAATGGAGCCCAGTTGG - Intergenic
1004399013 6:15271235-15271257 CAGGAGGGCTTGAGGCCAGTGGG + Intronic
1005421244 6:25653539-25653561 AAGGAAGAAAGGAGGTGAGTTGG - Intronic
1006150113 6:31982584-31982606 CAGGAGGGGAGGAGGCCAGTGGG - Intronic
1006156414 6:32015322-32015344 CAGGAGGGGAGGAGGCCAGTGGG - Intronic
1006164076 6:32054245-32054267 CTGGAGGCAGGGAGGCCAGTAGG - Intronic
1006249890 6:32774031-32774053 AATGAGGAATGGAACTCAGTGGG + Intergenic
1006731339 6:36238593-36238615 CAGGAGGAAGGGAGCAAAGTGGG + Intergenic
1007107870 6:39295754-39295776 GTGGAGGAAGGGGGGTCAGTGGG + Intergenic
1007341523 6:41194051-41194073 CAGGAAGGATGAGGGTCAGTGGG - Intronic
1008481739 6:51993177-51993199 CAGGTGGCAGGGAGGTGAGTGGG + Intronic
1012274648 6:97258121-97258143 CAACAGCAATGGAGGCCAGTGGG + Intronic
1012931870 6:105325909-105325931 AAGGAGGCAGGGAGATCAGTTGG + Intronic
1013224011 6:108106602-108106624 CAGGAGAAATGGAAGGCGGTTGG - Intronic
1014078328 6:117263373-117263395 CAGGGGGAATGGGGGTTGGTGGG - Intergenic
1014555697 6:122841098-122841120 GAGGAGGAATGGAGGGTAGAAGG - Intergenic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015653517 6:135491274-135491296 CAGGAGGTATGGAGCCCTGTAGG - Intronic
1017631206 6:156397695-156397717 CCGGAGGAAAGTGGGTCAGTAGG - Intergenic
1019294063 7:264706-264728 AAGGAGGAATGGGGCACAGTGGG + Intergenic
1020401281 7:7780332-7780354 TAGAAGGAAAGGAGGTCACTGGG - Intronic
1020503685 7:8956351-8956373 CAGGAAGAATGGATGGGAGTAGG - Intergenic
1020541274 7:9462967-9462989 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
1020619197 7:10497336-10497358 CAGGAGGGATGCAGGTGAATAGG + Intergenic
1021079358 7:16345164-16345186 CAGAAGTCATGGAGGTCAGAAGG + Intronic
1021162757 7:17297459-17297481 CTGGAGGAAAGAAGGACAGTGGG - Intergenic
1021433340 7:20586448-20586470 CAGTAGGTATGGAACTCAGTGGG - Intergenic
1021852392 7:24821431-24821453 GGGGAGGAAGGGAGGGCAGTGGG + Intronic
1021880656 7:25092575-25092597 AATGAGGAATGGAGGTTAGAGGG - Intergenic
1021979379 7:26039752-26039774 GAGGAGCAATGGAGTCCAGTTGG - Intergenic
1022500886 7:30881848-30881870 CAGGAGGAAAGGCTGGCAGTGGG + Intronic
1022659185 7:32350253-32350275 CAGGAGGGAGGGAGGTTAATGGG - Intergenic
1023115841 7:36861670-36861692 CAGGAGCGATGAAGTTCAGTTGG + Exonic
1023329211 7:39096272-39096294 CAGGAGAAATGGACATTAGTTGG + Intronic
1023341726 7:39228473-39228495 CAGGAGGGATGGATGTCAAATGG - Intronic
1023488422 7:40711629-40711651 ATGGAGGAATGGAGGTCTATGGG - Intronic
1026020084 7:66699229-66699251 CAGGAGGAATGGGGGGCACGGGG + Intronic
1027868362 7:83675040-83675062 CCGGAGGTATGGAAGTCAGCGGG + Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1028838255 7:95397687-95397709 GAGGAGGAATCGAAGTCAGGAGG + Intergenic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030751649 7:113238014-113238036 AAGGAGGAATGGAGGTTGGAAGG + Intergenic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1032443383 7:131959638-131959660 CAGGAGTGATGGTGGCCAGTGGG + Intergenic
1033063304 7:138128617-138128639 CAGGAGCAAGGGAGTGCAGTGGG + Intergenic
1034080041 7:148268229-148268251 CAGGTGGGAGGGAGGTCACTCGG + Intronic
1034217620 7:149420546-149420568 CAGGAGGAAGGAACGTTAGTTGG + Intergenic
1036225881 8:6957216-6957238 CAAGAGGGATGGAGGCCACTAGG + Intergenic
1036709777 8:11070864-11070886 CAGGAGGAATGAGGGGCAGCGGG - Intronic
1037767717 8:21782290-21782312 CTGGAGGAAGGGGGGTGAGTGGG - Intronic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1038869562 8:31479601-31479623 CAGGAGTGATGAAGGGCAGTTGG - Intergenic
1039026135 8:33260428-33260450 GAGGTGGAATGGATGTCAGGTGG - Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039886182 8:41655213-41655235 CAAGTGGAATGGAGGTATGTGGG + Intronic
1043782043 8:84348431-84348453 TGGGAGGAATGAATGTCAGTGGG - Intronic
1045695167 8:104801091-104801113 CAGGATCACTGGAGTTCAGTGGG + Intronic
1047177094 8:122552302-122552324 CGGTTGGAAGGGAGGTCAGTTGG - Intergenic
1047391929 8:124459369-124459391 CAGGAGGATTGCAGTTCAGGAGG - Intronic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1048767496 8:137860834-137860856 CTGGAGGAAGGGAGGAGAGTTGG + Intergenic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1051705172 9:19871197-19871219 CAGAAATAATGGAGGTCAGAAGG - Intergenic
1052070754 9:24078871-24078893 CAGGTGAAAGGGAGGACAGTGGG + Intergenic
1055268831 9:74532358-74532380 CAGGAGGAGTGAAGGAGAGTGGG - Intronic
1056620194 9:88206117-88206139 CAGGAGGAAAGGAGAAGAGTGGG + Intergenic
1056770853 9:89477021-89477043 CTGGAGGCATGGAGGAGAGTGGG + Intronic
1056970638 9:91198879-91198901 GAGGGGGAAGGGATGTCAGTGGG + Intergenic
1057586752 9:96335319-96335341 GAGGAAGAATGGAGGGGAGTTGG + Intronic
1057604388 9:96488775-96488797 AAGGATGAATGGAGGCCAGCAGG - Intronic
1058459729 9:105171922-105171944 CAGGTTGAATGGCGGTCAGCTGG + Intergenic
1059227138 9:112682545-112682567 CAGGAGGAAAGCAGGTTTGTGGG - Intergenic
1059922874 9:119177788-119177810 CAGGAGGAATTGGGGACAGAGGG + Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060803378 9:126558543-126558565 CAGGCTGAATGGTGGTCAGGTGG + Intergenic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1062243358 9:135551318-135551340 CAGGAGGAAGTGAGGCCTGTGGG + Intergenic
1185668504 X:1787493-1787515 CACCAGCAATGGTGGTCAGTGGG - Intergenic
1188927370 X:36061149-36061171 AAGGAGGAAGAGAGGGCAGTGGG - Intronic
1190153713 X:47969771-47969793 CAGGAGGAATAGAGAACAGGGGG + Intronic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1194778579 X:97995236-97995258 GAGGAGGAATTAAAGTCAGTAGG + Intergenic
1195637365 X:107133250-107133272 CAGTAGGAATGGAAGACAGCAGG - Intronic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198110221 X:133496378-133496400 GAGGAGAAATGGAGGTCTGTGGG + Intergenic
1198270373 X:135051401-135051423 CTGGAGGAGTGGAGGTGGGTTGG + Exonic
1198373931 X:136018682-136018704 AAGGAGCAATTGTGGTCAGTGGG + Intronic
1199309040 X:146301158-146301180 CATCAGGAATGGTGCTCAGTGGG + Intergenic
1199747035 X:150778414-150778436 CAGGAGGAATGGAGGTTCATGGG + Intronic
1200222851 X:154400296-154400318 CATGAGGAAAGGAACTCAGTCGG - Intronic