ID: 1197784525

View in Genome Browser
Species Human (GRCh38)
Location X:130187010-130187032
Sequence GTGGGAGCCCAGCCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197784525_1197784533 10 Left 1197784525 X:130187010-130187032 CCCCCAAAGGGCTGGGCTCCCAC No data
Right 1197784533 X:130187043-130187065 TGAGCTGTGTGCTGGAAGCCTGG No data
1197784525_1197784532 2 Left 1197784525 X:130187010-130187032 CCCCCAAAGGGCTGGGCTCCCAC No data
Right 1197784532 X:130187035-130187057 TCTGTGGATGAGCTGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197784525 Original CRISPR GTGGGAGCCCAGCCCTTTGG GGG (reversed) Intergenic
No off target data available for this crispr