ID: 1197785091

View in Genome Browser
Species Human (GRCh38)
Location X:130190852-130190874
Sequence CAACCCACTGGGCTTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197785091_1197785096 -3 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785096 X:130190872-130190894 TTGACACTTATGTCAACTCTGGG No data
1197785091_1197785099 14 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785099 X:130190889-130190911 TCTGGGCCAAAGGAGTCTCCGGG No data
1197785091_1197785102 30 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785102 X:130190905-130190927 CTCCGGGATGTCCTTGCCTTGGG No data
1197785091_1197785101 29 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785101 X:130190904-130190926 TCTCCGGGATGTCCTTGCCTTGG No data
1197785091_1197785097 4 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785097 X:130190879-130190901 TTATGTCAACTCTGGGCCAAAGG No data
1197785091_1197785098 13 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785098 X:130190888-130190910 CTCTGGGCCAAAGGAGTCTCCGG No data
1197785091_1197785095 -4 Left 1197785091 X:130190852-130190874 CCTCCAGGAAGCCCAGTGGGTTG No data
Right 1197785095 X:130190871-130190893 GTTGACACTTATGTCAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197785091 Original CRISPR CAACCCACTGGGCTTCCTGG AGG (reversed) Intergenic
No off target data available for this crispr