ID: 1197787740

View in Genome Browser
Species Human (GRCh38)
Location X:130216738-130216760
Sequence TCCCAAAGTTCAGGGAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587673
Summary {0: 1, 1: 95, 2: 8900, 3: 313308, 4: 265369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197787740_1197787750 8 Left 1197787740 X:130216738-130216760 CCTGTACTCCCTGAACTTTGGGA 0: 1
1: 95
2: 8900
3: 313308
4: 265369
Right 1197787750 X:130216769-130216791 TGGGCGGATCACTTGAGGTAAGG 0: 26
1: 3082
2: 26505
3: 79901
4: 132764
1197787740_1197787747 -8 Left 1197787740 X:130216738-130216760 CCTGTACTCCCTGAACTTTGGGA 0: 1
1: 95
2: 8900
3: 313308
4: 265369
Right 1197787747 X:130216753-130216775 CTTTGGGAGGCCGAGGTGGGCGG 0: 27130
1: 110883
2: 157143
3: 168159
4: 124493
1197787740_1197787751 26 Left 1197787740 X:130216738-130216760 CCTGTACTCCCTGAACTTTGGGA 0: 1
1: 95
2: 8900
3: 313308
4: 265369
Right 1197787751 X:130216787-130216809 TAAGGAGTTTGAGACCAGCCTGG 0: 348
1: 46772
2: 122988
3: 182738
4: 203272
1197787740_1197787749 3 Left 1197787740 X:130216738-130216760 CCTGTACTCCCTGAACTTTGGGA 0: 1
1: 95
2: 8900
3: 313308
4: 265369
Right 1197787749 X:130216764-130216786 CGAGGTGGGCGGATCACTTGAGG 0: 1078
1: 11705
2: 46114
3: 89604
4: 111833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197787740 Original CRISPR TCCCAAAGTTCAGGGAGTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr