ID: 1197795996

View in Genome Browser
Species Human (GRCh38)
Location X:130299406-130299428
Sequence AGGGAGAACCTGAAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197795996_1197796011 24 Left 1197795996 X:130299406-130299428 CCTCCAGCCTTCAGGTTCTCCCT No data
Right 1197796011 X:130299453-130299475 GGACCCATCCCTTCCTGCCCAGG No data
1197795996_1197796002 -8 Left 1197795996 X:130299406-130299428 CCTCCAGCCTTCAGGTTCTCCCT No data
Right 1197796002 X:130299421-130299443 TTCTCCCTGGCCTGAAGTTGGGG No data
1197795996_1197796000 -10 Left 1197795996 X:130299406-130299428 CCTCCAGCCTTCAGGTTCTCCCT No data
Right 1197796000 X:130299419-130299441 GGTTCTCCCTGGCCTGAAGTTGG No data
1197795996_1197796006 2 Left 1197795996 X:130299406-130299428 CCTCCAGCCTTCAGGTTCTCCCT No data
Right 1197796006 X:130299431-130299453 CCTGAAGTTGGGGCCTTACCCGG No data
1197795996_1197796007 3 Left 1197795996 X:130299406-130299428 CCTCCAGCCTTCAGGTTCTCCCT No data
Right 1197796007 X:130299432-130299454 CTGAAGTTGGGGCCTTACCCGGG No data
1197795996_1197796001 -9 Left 1197795996 X:130299406-130299428 CCTCCAGCCTTCAGGTTCTCCCT No data
Right 1197796001 X:130299420-130299442 GTTCTCCCTGGCCTGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197795996 Original CRISPR AGGGAGAACCTGAAGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr