ID: 1197801103

View in Genome Browser
Species Human (GRCh38)
Location X:130349923-130349945
Sequence CTTTTTTTGGGGATTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2280
Summary {0: 1, 1: 0, 2: 24, 3: 569, 4: 1686}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197801096_1197801103 21 Left 1197801096 X:130349879-130349901 CCTTTGAATCACTTTATTGTCCT 0: 1
1: 1
2: 1
3: 22
4: 272
Right 1197801103 X:130349923-130349945 CTTTTTTTGGGGATTGTGAAGGG 0: 1
1: 0
2: 24
3: 569
4: 1686
1197801097_1197801103 1 Left 1197801097 X:130349899-130349921 CCTAAAGTCAACTTTTTCTGAAG 0: 1
1: 0
2: 4
3: 43
4: 302
Right 1197801103 X:130349923-130349945 CTTTTTTTGGGGATTGTGAAGGG 0: 1
1: 0
2: 24
3: 569
4: 1686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197801103 Original CRISPR CTTTTTTTGGGGATTGTGAA GGG Intronic
Too many off-targets to display for this crispr