ID: 1197807469

View in Genome Browser
Species Human (GRCh38)
Location X:130411613-130411635
Sequence GTGTGAAAGGGGAAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197807462_1197807469 11 Left 1197807462 X:130411579-130411601 CCTTGCATTCACTGATAGTTGAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG 0: 1
1: 0
2: 3
3: 77
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197807469 Original CRISPR GTGTGAAAGGGGAAGGTGTG GGG Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900295709 1:1948183-1948205 TTCTGAAAGTGGAAGGGGTGCGG + Intronic
900850564 1:5139342-5139364 GTGTGAAAGGGCAGTGGGTGAGG + Intergenic
900923078 1:5685941-5685963 GGGGGAAAAGGGAAAGTGTGAGG - Intergenic
901206345 1:7498060-7498082 GTGAGAGTGGGGAAGGGGTGCGG + Intronic
901972730 1:12920532-12920554 GTGTGAATGGGAAAGGAATGAGG + Intronic
902012450 1:13281230-13281252 GTGTGAATGGGAAAGGAATGAGG - Exonic
902619151 1:17640342-17640364 GTGTGGAACGGGGAGGTTTGGGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903026191 1:20431140-20431162 GTGTGAAAGGGGTGGGGGTGGGG - Intergenic
903138474 1:21324577-21324599 GTGGGAAAGGGGCGGGGGTGGGG - Intronic
903143887 1:21357416-21357438 GTGTGAAAGGCTGAGGTGGGAGG - Intergenic
903344836 1:22677374-22677396 GTGTGGGAAGGGAAGGCGTGGGG - Intergenic
904035765 1:27557760-27557782 GTGTGTACTGGGCAGGTGTGGGG - Intronic
904064515 1:27738702-27738724 GTGTGAAAGAGAAAAGGGTGAGG + Intronic
904345239 1:29863772-29863794 GTGTGGGAAGGGAAGGGGTGGGG + Intergenic
905285878 1:36880006-36880028 GTGTGGCGGGTGAAGGTGTGAGG + Intronic
905481776 1:38266703-38266725 ATGGGAAAGGGGATGGTGTCGGG + Intergenic
905883841 1:41481271-41481293 GTGGGGATGGGGAAGGGGTGGGG - Intronic
905892711 1:41527293-41527315 GTGTGAAGTGTGAGGGTGTGAGG - Intronic
907267991 1:53274420-53274442 GTCTGAACGGGGAAGGAATGAGG + Intronic
907386524 1:54129142-54129164 GTGGGATAGGGGATGGGGTGGGG + Intergenic
907445693 1:54506417-54506439 CTGTGATGGGGGAGGGTGTGTGG + Intergenic
909528823 1:76658504-76658526 GTGTGAAGGGAGAAAGTGTAAGG - Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910354902 1:86342591-86342613 GTGTGAAAGGGAAATTTGTTGGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
912497592 1:110101546-110101568 GGGTGAAAGGGGGCCGTGTGCGG - Intergenic
913550445 1:119912512-119912534 GTGGGGAAGGGAAAGGTATGAGG - Exonic
914337048 1:146724862-146724884 GTGTGAAAGGGGAAGCCCAGGGG + Intergenic
914747872 1:150512694-150512716 GTGTGAAAGGGGCAGGGGTTAGG - Intronic
914807632 1:151003167-151003189 GTGTGAAGGGGCAGGGTGTGGGG - Intronic
914912637 1:151800006-151800028 GAGTGAAAGGGAAAGGATTGAGG + Intergenic
915596325 1:156898354-156898376 GCGGGAAAGGGGCAGGGGTGAGG - Intronic
916187156 1:162144682-162144704 GTGTCACAGAGGCAGGTGTGAGG - Intronic
916238967 1:162619997-162620019 GTTGGAAGGGGGAAGGTGTTGGG + Intergenic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917238167 1:172917163-172917185 ATGTGAAAGGGGTAGGAGTCAGG - Intergenic
917517382 1:175719318-175719340 GTGTGGATGGGGGAGGGGTGAGG - Intronic
917954741 1:180083223-180083245 GTGTGATTGAGGGAGGTGTGAGG + Intronic
919041034 1:192388512-192388534 GAGTGGAAGGGGAAGAGGTGTGG + Intergenic
920232710 1:204481145-204481167 GTGTGTATGGGGAGGGTGTGAGG - Intronic
920578060 1:207077539-207077561 TTGGGAAGGGGGATGGTGTGGGG + Exonic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921985219 1:221305499-221305521 GTGAGAAAGAGGAAGATGAGAGG + Intergenic
922618722 1:226978064-226978086 GTGTGCAGGGGTAAGGTGTGCGG - Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923072036 1:230574507-230574529 GTGTGCATGGGGGTGGTGTGGGG + Intergenic
923361628 1:233217684-233217706 GTGGTATGGGGGAAGGTGTGGGG - Intronic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924180483 1:241435124-241435146 GTGGGAAAGGGGTCGGGGTGTGG - Intergenic
1063880814 10:10530025-10530047 GTGTGAAGGGGAATGGTGAGTGG - Intergenic
1063949400 10:11208173-11208195 CTGTAAAATGGGAGGGTGTGGGG + Intronic
1064081142 10:12308938-12308960 GAGTTAAAGGGGAAGCTGGGGGG - Intergenic
1065009135 10:21405957-21405979 GTTGGAAAGGGGATGGTGTGGGG - Intergenic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1066449194 10:35512579-35512601 TTGTGAATGGGGAGGGAGTGTGG + Intronic
1066732671 10:38449370-38449392 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1066733000 10:38450640-38450662 GCGTGGAAGGGGCCGGTGTGAGG - Intergenic
1067103812 10:43351575-43351597 GTGTGACAGGGAAAGCTGTGAGG - Intergenic
1067530900 10:47072040-47072062 GGGAGAAAGGGGAAGTTGAGGGG - Intergenic
1069872157 10:71539861-71539883 GAGGGAAAGGGGAAGATGGGTGG - Intronic
1070312386 10:75283230-75283252 TGATGAAAGGGGCAGGTGTGAGG + Intergenic
1070678701 10:78433888-78433910 GCCTGAAAGAGGAAGGGGTGTGG + Intergenic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1071631527 10:87222686-87222708 GTGAGCAAGGGAAAGGAGTGCGG + Intergenic
1071752619 10:88497786-88497808 CTGTCCAAAGGGAAGGTGTGAGG + Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072288805 10:93943230-93943252 GGGTGAAAAGGGGAGGTGAGAGG - Intronic
1073274761 10:102300644-102300666 GGGGGAAAGGGGAATGTTTGTGG + Intronic
1074052262 10:109890775-109890797 GTGTGTATGTGGAGGGTGTGTGG + Intronic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074774645 10:116758273-116758295 GAGTGAAAGGGGAATGAGTGTGG - Intergenic
1076200486 10:128553908-128553930 GTGGCAGAGGGGAGGGTGTGAGG + Intergenic
1076732007 10:132443942-132443964 GAGGGGGAGGGGAAGGTGTGAGG - Intergenic
1077252377 11:1566374-1566396 GGGAGAGAGGGGCAGGTGTGAGG - Intronic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077349486 11:2085838-2085860 GTGTGGCAGGGCAGGGTGTGTGG + Intergenic
1077439320 11:2560631-2560653 GTGTGGAAGGGGAGGCTGAGGGG - Intronic
1078467621 11:11561865-11561887 AGGTGAAATGGGAGGGTGTGTGG - Intronic
1079578572 11:22033291-22033313 GGGGGAAAGGGCAGGGTGTGGGG + Intergenic
1080406211 11:31981711-31981733 CAGTGAAAAGGGAGGGTGTGGGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083257118 11:61503315-61503337 ATGGGAAAGGGGAAGTGGTGTGG + Intergenic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083742839 11:64720289-64720311 GTGTGGAAGGGGCAGGGGCGAGG + Intronic
1084192077 11:67503958-67503980 GTGGGAATGGGGAAGGACTGTGG - Intronic
1084492120 11:69484582-69484604 GTGTGAAACGGGAATGTTTCAGG + Intergenic
1084608964 11:70188701-70188723 GTGTGATGGGGGCAGGTGTGTGG - Exonic
1084796690 11:71510894-71510916 TTGGGAGAGGGGAAGGTGTTCGG + Intronic
1085715140 11:78865779-78865801 GTGGTACAGGAGAAGGTGTGTGG + Intronic
1087389425 11:97514881-97514903 GTTTGAAAAGAGAAGGAGTGTGG + Intergenic
1089300055 11:117493079-117493101 GTGTGCAAGGGGTAGGGGTGAGG + Intronic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1090801989 11:130178808-130178830 GGGTCAAAGGGAAAGGTGGGCGG + Intronic
1091307510 11:134546097-134546119 GTGTGTGGGGGTAAGGTGTGTGG - Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1091933515 12:4416450-4416472 GTGTGGAAGGGGAACCTGAGCGG + Intergenic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1095815294 12:46415461-46415483 GGGAGAAAGGGGAAATTGTGAGG - Intergenic
1096161592 12:49382946-49382968 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1096842052 12:54385650-54385672 GTATGAAAGGGGGTGGTGTCTGG - Intronic
1096982612 12:55737094-55737116 GTGTGAACGGTGAGGGTGTCAGG - Intergenic
1097325170 12:58268315-58268337 GAGGGAAAGGGGAAGTTGTGGGG - Intergenic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1099775527 12:87123186-87123208 GTGAGAAATGGGAGGGTATGTGG - Intergenic
1101063979 12:101000194-101000216 GTGTGTAATGGGAAAGTTTGAGG + Intronic
1101374028 12:104155256-104155278 GGGGGAAAGGGGGAGGTGGGGGG + Intergenic
1101448494 12:104755458-104755480 GTGTGGCAGGGGAGTGTGTGGGG + Intronic
1102200889 12:111056958-111056980 GTGTGACAGGAGGATGTGTGGGG + Intronic
1102200902 12:111057047-111057069 GTGTGACAGGAGATTGTGTGGGG + Intronic
1102517439 12:113459193-113459215 GTGTGCAAGGACATGGTGTGTGG + Intergenic
1102548109 12:113671200-113671222 GTGTGAAAAGGGAAAGTGACTGG - Intergenic
1103088096 12:118077497-118077519 CTGTGAAAGAGGAATGTTTGTGG + Intronic
1103987286 12:124776309-124776331 GTGTGAAAGGGGGAAGAGAGAGG - Intergenic
1103996780 12:124835150-124835172 GTGGAAAAGGGGAAAGTGTATGG + Intronic
1104009603 12:124920574-124920596 GAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1104471910 12:129036142-129036164 GTGTGAAGGGGGAGTGTCTGGGG - Intergenic
1104586437 12:130051779-130051801 GTGTGGAAGGAGATGGTGTGTGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105632040 13:22179133-22179155 GAGTGAAATGGGAAAGAGTGAGG - Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1108138657 13:47393925-47393947 GAGTGAAAGGGGAAAGTATGTGG + Intergenic
1108513670 13:51177433-51177455 TTGGGAATGTGGAAGGTGTGGGG - Intergenic
1109247625 13:59975976-59975998 GGGTGACAGGAGAAGGTGGGCGG - Intronic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1109502529 13:63256017-63256039 CTGTAATAGGGGGAGGTGTGAGG + Intergenic
1109510092 13:63360599-63360621 AAGTGAGAGGGAAAGGTGTGTGG + Intergenic
1109909725 13:68893427-68893449 GGGTAAAAGGGGAAGGAGAGGGG - Intergenic
1110466627 13:75809174-75809196 GTGAGAATGGGTAAGTTGTGTGG + Exonic
1110905846 13:80888276-80888298 GCGTGAAAGGAGAGGGTCTGGGG + Intergenic
1111268426 13:85850135-85850157 GTGTGGAAGGGAAATGTGGGTGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112826722 13:103400175-103400197 GTGGGATAGGGGGAGGTGGGAGG - Intergenic
1112897922 13:104323814-104323836 GAGTGAGAGGGGAAGGGATGGGG - Intergenic
1113552088 13:111200375-111200397 GAGAGAAAGGTGAAGGTGAGTGG - Intronic
1113813948 13:113159005-113159027 GGGGGAAAGGGGGAGGAGTGGGG + Intronic
1115770307 14:36659748-36659770 GTGAGAACTGGGAAGATGTGTGG + Intronic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1117910352 14:60631886-60631908 GTGTGAAAGAGGAAGATATAGGG + Intergenic
1118542396 14:66842473-66842495 GTGTGAAAGGGGAGGTTGTGGGG + Intronic
1118618660 14:67594663-67594685 GTGTGAAAGGAAAAGATTTGGGG - Intronic
1118667855 14:68089666-68089688 GGGGGAAAGGGGATGGTGGGAGG - Intronic
1119543803 14:75457536-75457558 GTTTCAATGGGGAAGGTATGAGG + Intronic
1119984686 14:79123989-79124011 GTGTGATATGGGATGGAGTGGGG - Intronic
1120651309 14:87136534-87136556 GTGTGAAAGGGGAGAGGGTAAGG - Intergenic
1120899509 14:89563677-89563699 GTATGGAAGGGGCAGGTGTGAGG + Intronic
1121722939 14:96124166-96124188 GTGTGCAAGGGAAATGTTTGGGG + Intergenic
1122080300 14:99262484-99262506 GTGGGAAAGGGAAGGATGTGGGG + Intronic
1122125541 14:99576648-99576670 GTGGGAAAGGGCAAGGCTTGGGG - Intronic
1122774095 14:104109649-104109671 GTGTGAGAGGGGCTGGGGTGTGG + Intronic
1122979959 14:105186947-105186969 GTGTGTAGGGGGTATGTGTGTGG + Intergenic
1123020405 14:105395339-105395361 CTGAGAGTGGGGAAGGTGTGAGG - Exonic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123054587 14:105563113-105563135 GTGTGATGGGTGAGGGTGTGTGG + Intergenic
1123133673 14:106008121-106008143 GTGTGCAATGAGAGGGTGTGGGG + Intergenic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1123451728 15:20369563-20369585 ATTTAAAAGGAGAAGGTGTGAGG - Intergenic
1124899075 15:33805901-33805923 GGGTGAAAGGGGAGGGGGAGAGG - Intronic
1124962312 15:34408178-34408200 GTGTGTATGGGGTATGTGTGTGG - Intronic
1124978936 15:34554400-34554422 GTGTGTATGGGGTATGTGTGTGG - Intronic
1125475833 15:40047556-40047578 GTCTGAAAGGGGCTGGAGTGGGG - Intergenic
1125555342 15:40580116-40580138 GTGTGACAGGAGAAGGAGGGAGG + Intergenic
1125788837 15:42347210-42347232 GTGAGGAAGGGGCATGTGTGGGG + Intronic
1126341250 15:47643386-47643408 GTTTGAAAGAGGAAGGGGTGAGG + Intronic
1126473246 15:49039070-49039092 TTGTTAAAAGGGAAGGGGTGGGG + Intronic
1127046821 15:55034718-55034740 GTGGGGAATGGGACGGTGTGGGG - Intergenic
1127353012 15:58171387-58171409 TTGTGAAAGGAAAAGGGGTGCGG - Intronic
1128636471 15:69305639-69305661 GCGTGAGAGGGGAAAGTGGGTGG - Intronic
1128739258 15:70072408-70072430 GGTTGAAAGGGGATGGGGTGAGG + Intronic
1128797490 15:70476406-70476428 GAGTGACAGGAGTAGGTGTGGGG + Intergenic
1129252389 15:74316092-74316114 GTGGGCAAGGGGCAGGGGTGGGG + Intronic
1130091035 15:80821631-80821653 GTGTGAGAGGGGACAGTGTGAGG + Intronic
1130835451 15:87645704-87645726 GTGTAAAGGGGGTAGGAGTGAGG - Intergenic
1130959276 15:88649027-88649049 GTCTGAAAAGGGAAGGAGTCGGG - Intronic
1131071697 15:89470228-89470250 GTGACAAAGGAGAAGGTGCGCGG - Intergenic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1131438253 15:92439865-92439887 GTGTTAAAGGTGAGTGTGTGGGG + Intronic
1132606813 16:797093-797115 GTGTGGAATGGGCAGCTGTGGGG + Intronic
1133498036 16:6338922-6338944 GAATGAAATGGGAAGGGGTGAGG + Intronic
1133813201 16:9177267-9177289 ATGGGAAAGGGGAAGGGGAGAGG - Intergenic
1135648526 16:24185435-24185457 GTATGACAGGGGAGGGTGGGAGG - Intronic
1135698469 16:24610773-24610795 GTGGAAAGGGGGAAGGTGAGAGG - Intergenic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136854984 16:33648115-33648137 GTGTTAAAGTTGAATGTGTGTGG + Intergenic
1137482740 16:48865824-48865846 GAGTGAAAGAGGCAGGTGGGGGG - Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138225769 16:55292960-55292982 GTGTGGGAGGTGGAGGTGTGAGG + Intergenic
1138772019 16:59676677-59676699 GTGAGAAAGGGCCAGATGTGAGG - Intergenic
1139340401 16:66264558-66264580 GAGTGAGCGGGGAAGGTGGGGGG - Intergenic
1139365469 16:66429707-66429729 GGGTGAATGGGGAAGGGGAGGGG - Intronic
1139573688 16:67828451-67828473 GTGAGAAGGCGGAAGGTGTGGGG - Intronic
1139797616 16:69496239-69496261 TTTTTAAAGGGGAAAGTGTGTGG - Intergenic
1139847882 16:69933353-69933375 GTGGGAACGGGGATGGTGTTGGG + Intronic
1139997222 16:70992457-70992479 GTGTGAAAGGGGAAGCCCAGGGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1141416922 16:83882836-83882858 ATGTGAAATGGGAAGTTTTGGGG + Intergenic
1141518097 16:84559740-84559762 GTCTGAAAGGGGAGGAGGTGGGG - Intergenic
1141545399 16:84764319-84764341 TGGTGAAGGGGGAAGGTGTGAGG + Intronic
1141982744 16:87560464-87560486 GTGAGAAGGGGGCAGGAGTGGGG + Intergenic
1142075660 16:88116151-88116173 GTGAGAATGGGCAAGATGTGGGG + Intronic
1142449973 16:90168794-90168816 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1203116564 16_KI270728v1_random:1496600-1496622 GTGTTAAAGTTGAATGTGTGTGG + Intergenic
1142970224 17:3606385-3606407 GTGGCAAAGGGAAGGGTGTGTGG + Intergenic
1143226617 17:5310335-5310357 GCGTGACAGGGGAAGATGTCGGG - Intronic
1143334024 17:6159050-6159072 GAGTGAGTGGGGAAGGTTTGGGG + Intergenic
1143485599 17:7251995-7252017 GTGTCAAAGGGGAAGAGGAGGGG - Exonic
1143699973 17:8651179-8651201 GGGTGTGTGGGGAAGGTGTGGGG + Intergenic
1143742988 17:8967259-8967281 CTGTGAAAGGGTGACGTGTGGGG - Intergenic
1143755509 17:9064421-9064443 GTGAGAAATGGGGAGCTGTGGGG - Intronic
1144014128 17:11177704-11177726 GTGATAAAGGGAAAGGTGTAGGG + Intergenic
1144625152 17:16840672-16840694 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1144881277 17:18432049-18432071 GGGTGAAATGGGAAGGAGTGAGG + Intergenic
1145150955 17:20512337-20512359 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1145263272 17:21367172-21367194 GTGGGAACGGGGAAGAAGTGTGG - Intergenic
1145289644 17:21533122-21533144 ATATGAAAGAGAAAGGTGTGGGG + Exonic
1145768842 17:27478244-27478266 GTATAAAAGGGGATGGTGTCAGG + Intronic
1145911573 17:28546382-28546404 GGGTGCAAGGGGAAGGTGTGGGG - Intronic
1146455220 17:33004425-33004447 AAGAGAAAGGGGAAGGTGTGAGG + Intergenic
1146508920 17:33429080-33429102 GTGTGTCAGGGTAAGGTGTCTGG + Intronic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147579305 17:41619371-41619393 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1147620495 17:41863554-41863576 GATTGAAATGGGAAGGTTTGGGG - Intronic
1148061977 17:44842920-44842942 GTGTTAAAGGGGAAGGGATGGGG - Intergenic
1148150609 17:45394728-45394750 CTGTAAAATGGGATGGTGTGTGG + Exonic
1148397237 17:47318885-47318907 GTGTGAAAGGGAGATGTGTTTGG + Intronic
1149633921 17:58150840-58150862 GTGTGCAAGGGGAAGGGTTCGGG - Intergenic
1150229664 17:63543252-63543274 GGGGGAGAGGGGATGGTGTGGGG - Intronic
1150421607 17:65041649-65041671 GTGTGCACGTGGAAGGGGTGTGG + Intronic
1150478600 17:65492268-65492290 GTGTGAGAGGGGGTGGGGTGAGG + Intergenic
1150607530 17:66707064-66707086 GTGTCATAGGGAAGGGTGTGTGG - Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152293363 17:79453311-79453333 TTTTGAAAGGGGGAGCTGTGTGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152755391 17:82084998-82085020 GTGGGGAAGGGGAAGTGGTGAGG + Intronic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1152806211 17:82357555-82357577 CTGGGATAGGGGCAGGTGTGGGG - Intergenic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153339399 18:3958943-3958965 GCTTGAAAGGGGAAGGTTCGAGG - Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154080067 18:11247665-11247687 GTGTGAAAGTGTGTGGTGTGAGG - Intergenic
1156810381 18:41242089-41242111 GTGTGATAGAGGAAAGTGTGAGG - Intergenic
1157089999 18:44625855-44625877 GTGAAGAAGGGGAAGCTGTGAGG + Intergenic
1157774277 18:50379457-50379479 GTGTGGAAGGGGTGGGAGTGAGG - Intronic
1157878309 18:51294321-51294343 GAGTGAAAAGGGAAGGAGTAAGG - Intergenic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1162185923 19:8904755-8904777 GTGTGTTAGGGGCAGATGTGAGG + Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1162776131 19:12980745-12980767 CTCTGAAAGGCCAAGGTGTGTGG - Intergenic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163632571 19:18424869-18424891 GGGAGAATGGGGAAGGGGTGGGG + Intronic
1164394295 19:27850366-27850388 GTGTGTGTGGGGAAGGGGTGTGG + Intergenic
1164579972 19:29428985-29429007 GTAGGAGAGGGGAAGGTGGGAGG + Intergenic
1165141861 19:33704465-33704487 GGGGGAAAGGGGATGGGGTGAGG + Intronic
1165610422 19:37146731-37146753 GGGGGAAAGGGGCAGGAGTGGGG - Intronic
1165763505 19:38336236-38336258 GCGTGGAAGGAGAAGGTGTGGGG + Intronic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166961043 19:46495945-46495967 GGGGGACAGGGGAGGGTGTGCGG - Exonic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1168172314 19:54596892-54596914 GAGTGAAGGGGGAAGGTCTGCGG + Intronic
1168316914 19:55488544-55488566 GGGTGAAAGGGGAAGGAGAGCGG - Intronic
1202637199 1_KI270706v1_random:52803-52825 GAGTGAAAGGTGAGGGTGGGGGG - Intergenic
925281909 2:2690848-2690870 GTGTGAGATGTGAATGTGTGTGG - Intergenic
925281982 2:2691112-2691134 GAGTGAGAGAGGAGGGTGTGAGG - Intergenic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
926095209 2:10076998-10077020 ATGTGGAAGGGGCAGGTTTGGGG - Intronic
926464726 2:13174366-13174388 GTGGGAAAGAGGAAGGAATGAGG - Intergenic
927100507 2:19784291-19784313 GTGTGTATGGGGTATGTGTGTGG - Intergenic
927386826 2:22544186-22544208 GGGAGAGAGGGCAAGGTGTGAGG + Intergenic
927465354 2:23332450-23332472 GTGGGAAAGAAGAAAGTGTGAGG - Intergenic
927902780 2:26833296-26833318 GTTTGAAAGGCCAAGGTGGGAGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930288525 2:49465351-49465373 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
930288545 2:49465408-49465430 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
931738064 2:65216165-65216187 GTAAGAAAGAGGAAGGGGTGGGG - Intergenic
931881409 2:66574970-66574992 GTGGGGAAGGGGAAGGGGTGGGG - Intergenic
931948095 2:67332747-67332769 GTGGGAAAGGGGTCGGGGTGTGG - Intergenic
932127109 2:69154612-69154634 GAGTGACAGAGGAAGGTTTGAGG - Intronic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
932592308 2:73074814-73074836 GTGTCACATGGGAATGTGTGGGG - Exonic
932621373 2:73266390-73266412 ATGTGAAAGGTGAGGTTGTGGGG + Intronic
932681540 2:73829698-73829720 GTTTTAGAGGGGAAGGTTTGTGG + Intronic
932895716 2:75637667-75637689 GTGTGAGAGAGGAAGGGGTCAGG - Intergenic
933483500 2:82888031-82888053 GTTTGAAAGGCCAAGGTGGGCGG + Intergenic
933898052 2:86829041-86829063 ATGTGACAGGGGTTGGTGTGGGG - Intronic
934104991 2:88687325-88687347 GTGTGAGAGTGGAGGGTGTGAGG + Intergenic
934979956 2:98831473-98831495 AGGTGACAGGGGAAGGTGTGTGG + Intronic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937883515 2:126885571-126885593 GGCTGAAAAGGGAAGGTGTGAGG + Intergenic
938114235 2:128592397-128592419 GGGTGAAAGGAGGAGATGTGGGG + Intergenic
938119984 2:128626443-128626465 GTGTGCAAGGGGGAGATGTGGGG - Intergenic
939129747 2:138220632-138220654 GGGTTAAAGGGGAAGAAGTGAGG - Intergenic
939177188 2:138762083-138762105 GGGAGAAAGGAGCAGGTGTGAGG + Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
944481894 2:200165715-200165737 GTGAGAAAGGGGAAGGTTTGAGG - Intergenic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945895971 2:215482042-215482064 GTGTTAAAGAGGTAGCTGTGTGG - Intergenic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946716173 2:222556786-222556808 GGGTGGATGGGGAAGGAGTGAGG - Intronic
946716194 2:222556847-222556869 GGGTGGATGGGGAAGGAGTGAGG - Intronic
947722445 2:232378264-232378286 GTGGGAAAGGGGCACGTGGGGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948253802 2:236551611-236551633 GGGGGAAAGGGGAAGGAGTCTGG - Intergenic
948367230 2:237464881-237464903 GTGTGAGTGGGGTATGTGTGGGG + Intergenic
948659393 2:239497823-239497845 GTGTGGAAACGGAGGGTGTGGGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
1169081467 20:2799938-2799960 TGGTGAAAAGGGAAGGTTTGGGG + Intronic
1169289073 20:4333130-4333152 ATGTGAGTGGGGAAGGAGTGGGG + Intergenic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1170795964 20:19546861-19546883 GGGTGGAAAGGGAAGGCGTGGGG - Intronic
1171215631 20:23350463-23350485 GAGAGGGAGGGGAAGGTGTGTGG - Intergenic
1172214554 20:33225769-33225791 GTGTGAAAATGTACGGTGTGTGG - Intronic
1172744099 20:37193409-37193431 GATTGAAAGGAGGAGGTGTGTGG + Intronic
1173179848 20:40797746-40797768 GTGTCAAAGGGCCAGGGGTGAGG + Intergenic
1174109253 20:48186637-48186659 GTGGGAGTGGGGAATGTGTGGGG - Intergenic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1174394665 20:50239570-50239592 GTGTGATAGAGAAAGGCGTGGGG + Intergenic
1174404278 20:50293687-50293709 GGGTGAAGGAGGAAGCTGTGGGG - Intergenic
1174602482 20:51736007-51736029 GAGTGAATGAGGAAGGGGTGTGG + Intronic
1174699291 20:52591202-52591224 GTGTGACAAGGGAATATGTGCGG + Intergenic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175793216 20:61755559-61755581 GTGTGTATGGGGCATGTGTGTGG - Intronic
1177100456 21:16893321-16893343 GTGGGAAAGGGGTTGGGGTGTGG - Intergenic
1177499870 21:21940090-21940112 GAGTGATAGGGAAAGGGGTGGGG + Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1178359378 21:31935314-31935336 GTGAGTAGGGGGAAGGTATGCGG - Intronic
1179377313 21:40862190-40862212 GTGAAAAAGTGTAAGGTGTGGGG + Intergenic
1179793087 21:43766864-43766886 CTGTGAAAGGGGAGGGCCTGGGG + Intergenic
1180228652 21:46413235-46413257 GTGGGGAGGGGGAAGGCGTGAGG + Intronic
1180609659 22:17086824-17086846 GTGGGACAGGGTACGGTGTGTGG + Intronic
1180986838 22:19909902-19909924 GTGTGAAGGGTGTGGGTGTGTGG - Intronic
1181458675 22:23073570-23073592 GTGTGGCAGGGGCTGGTGTGGGG - Intronic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1181957425 22:26598171-26598193 GTGTGAAAGAGGACCGGGTGCGG - Intergenic
1182276907 22:29195541-29195563 GAGGGAAAGGGGACGGTGTAGGG + Intergenic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1182442567 22:30372794-30372816 TAGTGAAAGGGGCAGGTCTGGGG + Intronic
1182654805 22:31881373-31881395 GTGTGAGAAGTGAAGGGGTGGGG + Intronic
1182997258 22:34825661-34825683 GTGTGAGGGATGAAGGTGTGAGG - Intergenic
1183341969 22:37286537-37286559 GTGGGGAATGGGAAGGGGTGGGG + Intronic
1183567805 22:38628704-38628726 GGGTGACAGGGGAGGCTGTGGGG + Intronic
1183888943 22:40909308-40909330 TTGTGAAAGCTGAAGGTGAGAGG - Intronic
1184259159 22:43304845-43304867 GTGTGCAAAGGGATGGTGTGGGG - Intronic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1185046193 22:48529772-48529794 GTGTGGACGGGGAGGGTGTGTGG + Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185345711 22:50309665-50309687 GTGTGAAGGGGGAACTTGAGGGG - Exonic
949198024 3:1336826-1336848 GTGTCCAAGAGGAAGGTGTCTGG - Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
950379976 3:12604245-12604267 GTGTTAAAGGTGAAGGCGTGAGG + Exonic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951010942 3:17678599-17678621 GTGTAGAAGGGGGATGTGTGAGG - Intronic
951718051 3:25670121-25670143 GTGAGAAACAGGATGGTGTGAGG + Intergenic
951962782 3:28348391-28348413 GGGTGACAGGGGAAAGGGTGTGG + Intronic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
953421098 3:42753905-42753927 ATGTGAATGGGGAAGTTGTATGG + Intronic
954144603 3:48628317-48628339 GGGAGAAAGGGGAAGGGATGAGG + Intronic
955891779 3:63657914-63657936 GGGTGAAAGGAGGAAGTGTGTGG - Intronic
956075686 3:65502824-65502846 ATGTGAAAAGAAAAGGTGTGTGG + Intronic
956631403 3:71320131-71320153 GTGTGACTGGGGAAGCTGTCTGG - Intronic
956666539 3:71647512-71647534 GTGTGAATTGAGAAGGTATGAGG - Intergenic
959378012 3:105608714-105608736 GTAAGAAAGGGGATGGTGCGGGG - Intergenic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
961475076 3:127141113-127141135 GAGCGCAAGGGGAAGGTGCGGGG - Intergenic
961845417 3:129759114-129759136 GTGTGAACATGGAAGGTTTGTGG + Intronic
962108499 3:132417646-132417668 GGGGGAAAGGGGAAGTGGTGAGG + Exonic
962317040 3:134365398-134365420 GTGTGCAATGGGAATGTGAGAGG - Intronic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
963511389 3:146252204-146252226 GTTGGAAAGGGGAAGGGATGTGG + Intergenic
963608924 3:147440774-147440796 TTGTGGAAGGGGAAGGTTTTGGG + Intronic
963711029 3:148747489-148747511 GTGTTAAGGGGGAAGAGGTGTGG + Intergenic
964146492 3:153470397-153470419 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
964753599 3:160074784-160074806 GTCTGGGAGGGGAAGCTGTGGGG + Intergenic
964806056 3:160610922-160610944 GTATGAAAGGAGATGGTCTGAGG + Intergenic
964950499 3:162286088-162286110 GGGTGAATGGTGGAGGTGTGAGG + Intergenic
966078037 3:175963013-175963035 GTGTGGATGGAGAAGATGTGAGG + Intergenic
966226472 3:177603401-177603423 TTGTAAAAGGGAAAGGGGTGAGG - Intergenic
966686431 3:182700945-182700967 ATGTGCAAGGGTAGGGTGTGAGG - Intergenic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
967452857 3:189646615-189646637 TCGTGAAAGGGAAAGGTGTATGG - Intronic
967851077 3:194083280-194083302 TTGTGAAAGGGGTAGGACTGGGG - Intergenic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968868598 4:3229092-3229114 GTGTGCAAGTGGCATGTGTGTGG - Intronic
969413935 4:7046701-7046723 GTGTGGAAGGAGATGGTGTGGGG + Intronic
969427088 4:7130707-7130729 GTGTGAGAGAGTATGGTGTGTGG + Intergenic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970124878 4:12797871-12797893 GAGTGGAAGGGGAAAGTGTGGGG - Intergenic
970211730 4:13716939-13716961 GTTTTAAAGTGGGAGGTGTGAGG - Intergenic
971158231 4:24105819-24105841 GTGTCCAAGGGGAAGGTTTTCGG + Intergenic
971303720 4:25462788-25462810 GTTTGAAAGGGAGTGGTGTGGGG - Intergenic
971506359 4:27370267-27370289 GTGAGAAAAGGGAAGGGGAGGGG - Intergenic
971929174 4:33056625-33056647 GTGTGAAATAGAAAAGTGTGGGG + Intergenic
973393605 4:49576262-49576284 GAGTGAAAGGTGAGGGTGGGGGG + Intergenic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974711271 4:65598958-65598980 GTGTGAAGGGGGGAGGTTTCAGG + Intronic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
976144737 4:82031529-82031551 GTGTGACTGGGGAAGATGGGGGG - Intronic
976161961 4:82211136-82211158 GGGTGGAAGGGGAAGGTGCTGGG + Intergenic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
977249483 4:94674118-94674140 GAGTGTCAGGGGAAAGTGTGGGG - Intergenic
977826612 4:101539929-101539951 GTGTGAAAGAGCATGGGGTGGGG - Intronic
978379291 4:108110032-108110054 GTGTGAAAGGGAAAGTAATGAGG + Intronic
980136507 4:128863334-128863356 GTGTGAAAGAGGTGGGAGTGAGG + Intronic
980878353 4:138684963-138684985 ATGGGAAAGGTGAGGGTGTGAGG + Intergenic
980931803 4:139189191-139189213 GTGGGAAAGAGGAAGGTCTTAGG + Intergenic
981040085 4:140214715-140214737 GTGGGAAAGGGGTCGGGGTGCGG - Intergenic
981486753 4:145294940-145294962 GTGTGACTGGGGAATGAGTGAGG - Intergenic
983856858 4:172657733-172657755 GTGTGAAAGGAAAGAGTGTGAGG + Intronic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985484489 5:140813-140835 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484577 5:141049-141071 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484585 5:141071-141093 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985484593 5:141093-141115 GTGTGCAGGGGGAGGTTGTGGGG - Intronic
985870261 5:2548781-2548803 GAGTGCAAGGGGCAGGTATGAGG - Intergenic
985937180 5:3106349-3106371 GGATGGAAGGGGAAGGTGAGGGG + Intergenic
986314965 5:6580994-6581016 GTGTGAGAGGGGGAAGTGTGGGG - Intergenic
986328864 5:6702951-6702973 GAGTGAGAGGGGAAGGGGAGAGG - Intergenic
986806317 5:11311853-11311875 GTGGGAAGGGGGAGTGTGTGGGG - Intronic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987238191 5:15964898-15964920 GCCTGAAAGGGGAAAGTTTGGGG + Intergenic
987539514 5:19236017-19236039 GTGTGAAGGAGGTAAGTGTGTGG - Intergenic
990637755 5:57748529-57748551 TTGAGATAGAGGAAGGTGTGGGG + Intergenic
991046871 5:62232050-62232072 GTGTTAAAGTTGAATGTGTGTGG - Intergenic
991245498 5:64505327-64505349 GTGTGAAAGGAGTGGGGGTGAGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993050973 5:82925500-82925522 GTGTGTTAGGGGAAGTTGTCAGG + Intergenic
993204195 5:84859564-84859586 GTGGGAAATGGGGATGTGTGAGG + Intergenic
993968494 5:94387813-94387835 GTGTGAGAGGTAAAGCTGTGGGG + Intronic
994682717 5:102909131-102909153 GAGAGAATTGGGAAGGTGTGAGG - Intronic
995183704 5:109251138-109251160 GTGTGGGAGGGGAAAGGGTGGGG - Intergenic
995623069 5:114049182-114049204 GTGAGAAAGTGAATGGTGTGAGG + Intergenic
995856776 5:116600854-116600876 ATGGGAAAGGGGAGGGTCTGGGG + Intergenic
995924340 5:117352462-117352484 GTGGGTAAGGGGAAGCTTTGTGG + Intergenic
996853377 5:127977699-127977721 GGGTGAGGGGGGAAGGAGTGAGG - Intergenic
997205261 5:132044413-132044435 GAGTGAATGGGGAAGAAGTGGGG - Intergenic
997229094 5:132229764-132229786 GTGTGGAGGGGGAAGATGTAGGG - Intronic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997500783 5:134371705-134371727 GTCACAAAGGGGAAGGTGTCTGG - Intronic
998103563 5:139454484-139454506 GTGTGAAGGTGTATGGTGTGTGG + Intronic
998204273 5:140147930-140147952 GGGTGAATGGGGAAGCTCTGTGG - Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999077012 5:148806034-148806056 GAGTGGGAGGGGAAGGGGTGTGG + Intergenic
1001418886 5:171571825-171571847 GTGAGAAAGGGGAGCATGTGGGG + Intergenic
1002408576 5:179055248-179055270 GTGTGAAGGGCTAAAGTGTGGGG + Intergenic
1003335851 6:5171502-5171524 GTGTGTTAGGGGAAGTGGTGGGG + Intronic
1003955574 6:11162206-11162228 ATGGGAAAGGGCAGGGTGTGTGG + Intergenic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1005364140 6:25060511-25060533 GTGTGGAAAGGGGAGGGGTGTGG + Intergenic
1005890332 6:30132094-30132116 GTGTGAAAGAGGTAGGAGTTAGG + Intergenic
1005952315 6:30641161-30641183 GTGAGGAAGAGGAAGGAGTGGGG - Intronic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1008661180 6:53669865-53669887 GTGTGAATGGTGCAGGTGTATGG + Intergenic
1009438101 6:63641404-63641426 GTGTGTAGGGGGGTGGTGTGAGG - Intronic
1010060123 6:71613272-71613294 GTGAGAAAGGGGCAGGGGTGAGG - Intergenic
1010625139 6:78130147-78130169 TTGTGGAAGGGGAAGATCTGTGG - Intergenic
1010788132 6:80029637-80029659 GTCAGGAAGGGGAAGGAGTGAGG + Intronic
1012386899 6:98692884-98692906 GAAGGAAAGGGGAAGGTGTGGGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013101614 6:106991974-106991996 GAGTCAAGGGGAAAGGTGTGAGG - Intergenic
1013305835 6:108846624-108846646 GAGTGGAAAGGGAAGATGTGTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014015937 6:116529876-116529898 GTGTGTAAGAGGAGTGTGTGCGG + Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015570844 6:134619796-134619818 GTGAGAATGGGGGAGGTTTGAGG + Intergenic
1017067594 6:150543548-150543570 GTGTGAGAGGGGTAGGGGTAAGG - Intergenic
1018258591 6:161947543-161947565 GTGTGAAGGAGGGAGGTGAGTGG - Intronic
1019057864 6:169236030-169236052 GTGTGGATGGGGAGGGAGTGTGG - Intronic
1019057897 6:169236171-169236193 GTGTGGATGGGGAATGAGTGTGG - Intronic
1019057973 6:169236526-169236548 GTGTGGATGGGGAATGAGTGTGG - Intronic
1019058012 6:169236727-169236749 GTGTGGATGGGGAATGAGTGTGG - Intronic
1019155787 6:170038059-170038081 CTGTCACAGGGGAGGGTGTGGGG + Intergenic
1019898780 7:4003358-4003380 GTGTCACAGGGGAAGCTGGGTGG - Intronic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1021444667 7:20719581-20719603 GTGGGAAAGGGGTAGGGCTGGGG + Intronic
1021637139 7:22704408-22704430 GTGGGAAAGGGGTCGGGGTGTGG - Intergenic
1021907257 7:25347468-25347490 GTGGGAAAAGAGAAGGTGTCTGG + Intergenic
1022385371 7:29893819-29893841 GGGTGTAAGGGAAAGCTGTGGGG - Intronic
1022711752 7:32857138-32857160 GAGTGAAAGGGGCAGATGTGGGG - Intergenic
1022912907 7:34917818-34917840 GAGTGAAAGGGGCAGATGTGGGG + Intergenic
1023926714 7:44674897-44674919 GTGAAAATAGGGAAGGTGTGGGG + Intronic
1023940913 7:44767944-44767966 GGGTGGAAGGACAAGGTGTGAGG - Exonic
1024074974 7:45813609-45813631 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1024074986 7:45813658-45813680 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1024074998 7:45813707-45813729 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1024221927 7:47295702-47295724 GTGTGAGAGTGGAAGGGGTGGGG - Intronic
1025129621 7:56368608-56368630 GCGTGAGAGGGGCCGGTGTGAGG + Intergenic
1025129640 7:56368705-56368727 GCGTGAGAGGGGCCGGTGTGAGG + Intergenic
1025129791 7:56369303-56369325 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025130075 7:56370474-56370496 GCGTGAGAGGGGCCGGTGTGAGG + Intergenic
1025130098 7:56370556-56370578 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025130395 7:56371772-56371794 GCGTGAGAGGGGCCGGTGTGAGG + Intergenic
1025130418 7:56371854-56371876 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025130715 7:56373070-56373092 GCGTGAGAGGGGCCGGTGTGAGG + Intergenic
1025130739 7:56373152-56373174 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025131030 7:56374363-56374385 GCGTGAGAGGGGCCGGTGTGAGG + Intergenic
1025131053 7:56374445-56374467 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1026323097 7:69284457-69284479 GCCTGAAAGGGGAAGGAATGGGG - Intergenic
1026649733 7:72205444-72205466 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1026674848 7:72419884-72419906 GCTGGAAAGGGGATGGTGTGGGG - Intronic
1027591509 7:80124870-80124892 GTGGTAAAGGTGAAGGGGTGGGG - Intergenic
1027779900 7:82507899-82507921 GTGTGAAAGGGGAAGCCTAGAGG - Intergenic
1028113973 7:86976547-86976569 GTGTGGAGGGGGCAGGTGAGGGG - Intronic
1028333746 7:89626171-89626193 GGGTAAAAGGGGAAGGAGAGGGG + Intergenic
1028682523 7:93553039-93553061 TTTTGAAAGAAGAAGGTGTGAGG - Intronic
1028975901 7:96913719-96913741 GCATGAAAGAGGCAGGTGTGGGG - Intergenic
1029174248 7:98652718-98652740 GAGAGAAAGGGGAAGATGTTGGG - Intergenic
1031273213 7:119681556-119681578 GTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1031847119 7:126819226-126819248 GTGAGAAAGGGGAGAGTGAGGGG - Intronic
1033222484 7:139537606-139537628 GTATGAGAGGGGATGGGGTGAGG + Intronic
1033281474 7:140009576-140009598 GTGGGTGTGGGGAAGGTGTGGGG - Intronic
1033943280 7:146681601-146681623 GTGGGAAAGGGGAGAGTGGGAGG + Intronic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1034459580 7:151191135-151191157 CTGTAAAAGGGGGAGGGGTGAGG - Intronic
1035392158 7:158511613-158511635 GTGTGAGAGGCAAAGCTGTGCGG - Intronic
1035832567 8:2713603-2713625 GAAAGAATGGGGAAGGTGTGGGG - Intergenic
1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG + Intronic
1036071283 8:5442240-5442262 GTGACAGAGGGGAAGGTGTCAGG - Intergenic
1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG + Intergenic
1036639322 8:10572409-10572431 GTGGGAAAGGGGTCGGGGTGTGG - Intergenic
1036752152 8:11450107-11450129 GTGTGAAAGAGCATGGTGTCCGG - Intronic
1038376574 8:27046099-27046121 TTGTGAAATGGAAAGCTGTGAGG + Intergenic
1038507047 8:28093234-28093256 GTGCGAAAGGGGAAGGAGATGGG + Intronic
1041342302 8:56858680-56858702 GTGTATGAGGGGATGGTGTGGGG - Intergenic
1041608973 8:59821174-59821196 GTGTGAAGAGGTAGGGTGTGGGG + Intergenic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043472747 8:80578494-80578516 GCGGGAGAGGGGAAGGAGTGGGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044574277 8:93751430-93751452 GTGAGAAAGGGGAATTAGTGAGG - Intergenic
1045275621 8:100702254-100702276 TTGTTAAAGGTGAAGATGTGGGG - Intronic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1047247496 8:123158103-123158125 GAGTGAAAGGGAAAGGAGAGCGG - Intergenic
1047523590 8:125614514-125614536 GTGTGTGAGGGTCAGGTGTGAGG + Intergenic
1047523597 8:125614554-125614576 GTGTGTAAGGGTCAGGTGTGAGG + Intergenic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1049238363 8:141524186-141524208 CTGTGAAATGGGAGGCTGTGGGG + Intergenic
1049511428 8:143028649-143028671 GGGTGAAAGAGGAGGGTGTCTGG + Intergenic
1049689115 8:143951055-143951077 GGGGGAAAGGGGCAGCTGTGGGG - Intronic
1050217616 9:3345302-3345324 GTATGAAAGGGGAATATTTGGGG + Intronic
1050330591 9:4541505-4541527 GTGTGAAAGAGGAAAGAGGGAGG + Intronic
1051748135 9:20315253-20315275 GTGTTAATGGGGAAGATGCGGGG + Intergenic
1051768634 9:20551365-20551387 GTGAGAAAGAGGATGGGGTGGGG - Intronic
1053025093 9:34722997-34723019 TTGTGTTAAGGGAAGGTGTGAGG - Intergenic
1053036617 9:34832059-34832081 TTGTGTTAAGGGAAGGTGTGAGG - Intergenic
1056550187 9:87646362-87646384 TTGAGACAGGGGAAGGTGTGTGG + Intronic
1057334394 9:94144349-94144371 GCGGGAAATGGGAAGCTGTGGGG - Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1059227099 9:112682305-112682327 TTGGGAAAGGGGAACATGTGAGG - Intergenic
1059397529 9:114047544-114047566 GTGTGCAGGGAGTAGGTGTGGGG + Intronic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060972255 9:127744943-127744965 GTGTGGGAGGGGCTGGTGTGGGG + Exonic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061419614 9:130466249-130466271 GTGTGGAAGGGAAAGAAGTGGGG - Intronic
1061800762 9:133112436-133112458 GTGTGGAAGGGGATGGCTTGAGG - Intronic
1061802939 9:133121951-133121973 GTCTGTAAGGGGATAGTGTGGGG - Intronic
1061995347 9:134180342-134180364 GGGTGAATGGGGAGGGAGTGGGG - Intergenic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062119467 9:134826495-134826517 GTGTGCATGTGGATGGTGTGTGG + Intronic
1062535282 9:137018563-137018585 GTTTGGAAGGGGCAGGGGTGGGG + Intronic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1185765549 X:2723273-2723295 GTCTGCAATGGGAAGGTTTGGGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186151431 X:6678668-6678690 GAGTGAAAGGGTACAGTGTGTGG + Intergenic
1187132271 X:16514253-16514275 GTGTGTAGGGAGAAAGTGTGTGG + Intergenic
1187514984 X:19960791-19960813 GTTTGAAAGGGGATGAGGTGGGG - Intronic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188734594 X:33696748-33696770 GGGTGCAAGGGGAAGGGGAGGGG + Intergenic
1189034327 X:37480044-37480066 GGGTAAAAGGGGAAGGAGAGGGG + Intronic
1189282348 X:39827757-39827779 GTGGGGAGGGGGCAGGTGTGGGG - Intergenic
1192168802 X:68841900-68841922 GTGTGGAGGTGGATGGTGTGAGG - Exonic
1192370974 X:70512636-70512658 GTCTGATAGGGGAAGGGGTTAGG - Intergenic
1193350374 X:80456863-80456885 ATGTGCAAGGGAAATGTGTGTGG - Intergenic
1194834313 X:98662064-98662086 GTGTGAAAGAGGAACTTTTGAGG + Intergenic
1195688317 X:107604295-107604317 GGGGGAAAGGGGTAGGGGTGGGG + Exonic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1197541235 X:127764493-127764515 GTTTTTAAGGGGCAGGTGTGAGG - Intergenic
1197766931 X:130065450-130065472 GTGTGAAAGTGGGAGATGAGGGG + Exonic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198410606 X:136363253-136363275 GTGGGAAGGGGGAAGGGGAGTGG - Intronic
1198672991 X:139101650-139101672 GTGTGAAAGGGGATAGATTGAGG - Intronic
1199874305 X:151919306-151919328 ATGGGAAAGGGGAGGGGGTGGGG - Intronic
1199944434 X:152653927-152653949 GCGTGGAAGGGGAATGTGGGTGG + Exonic
1200052133 X:153439500-153439522 GTGTGTCAGGGGAGTGTGTGTGG + Intergenic
1202380847 Y:24275952-24275974 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1202380858 Y:24276000-24276022 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1202489926 Y:25394125-25394147 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1202489937 Y:25394173-25394195 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic