ID: 1197807970

View in Genome Browser
Species Human (GRCh38)
Location X:130415648-130415670
Sequence CCAGTTACACACTTAGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197807961_1197807970 23 Left 1197807961 X:130415602-130415624 CCAAGGAGCCCTGGGGGCATTCA No data
Right 1197807970 X:130415648-130415670 CCAGTTACACACTTAGGGCTAGG No data
1197807963_1197807970 14 Left 1197807963 X:130415611-130415633 CCTGGGGGCATTCATTACTCCTA No data
Right 1197807970 X:130415648-130415670 CCAGTTACACACTTAGGGCTAGG No data
1197807962_1197807970 15 Left 1197807962 X:130415610-130415632 CCCTGGGGGCATTCATTACTCCT No data
Right 1197807970 X:130415648-130415670 CCAGTTACACACTTAGGGCTAGG No data
1197807965_1197807970 -5 Left 1197807965 X:130415630-130415652 CCTACTGCCAGGTCAATTCCAGT No data
Right 1197807970 X:130415648-130415670 CCAGTTACACACTTAGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197807970 Original CRISPR CCAGTTACACACTTAGGGCT AGG Intergenic
No off target data available for this crispr