ID: 1197808279

View in Genome Browser
Species Human (GRCh38)
Location X:130417639-130417661
Sequence CTCCCATAGGGAAAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197808269_1197808279 18 Left 1197808269 X:130417598-130417620 CCAAGATGAGATTAGATGTATGA No data
Right 1197808279 X:130417639-130417661 CTCCCATAGGGAAAATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197808279 Original CRISPR CTCCCATAGGGAAAATGGGG AGG Intergenic
No off target data available for this crispr