ID: 1197814248

View in Genome Browser
Species Human (GRCh38)
Location X:130480367-130480389
Sequence TGAGCGTCCTGCCCCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197814248_1197814255 10 Left 1197814248 X:130480367-130480389 CCACCTCAGGGGCAGGACGCTCA No data
Right 1197814255 X:130480400-130480422 AGGTCTGCTGTGGTCTGCAAAGG No data
1197814248_1197814251 0 Left 1197814248 X:130480367-130480389 CCACCTCAGGGGCAGGACGCTCA No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data
1197814248_1197814256 11 Left 1197814248 X:130480367-130480389 CCACCTCAGGGGCAGGACGCTCA No data
Right 1197814256 X:130480401-130480423 GGTCTGCTGTGGTCTGCAAAGGG No data
1197814248_1197814250 -10 Left 1197814248 X:130480367-130480389 CCACCTCAGGGGCAGGACGCTCA No data
Right 1197814250 X:130480380-130480402 AGGACGCTCAGCCCTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197814248 Original CRISPR TGAGCGTCCTGCCCCTGAGG TGG (reversed) Intergenic
No off target data available for this crispr