ID: 1197814250

View in Genome Browser
Species Human (GRCh38)
Location X:130480380-130480402
Sequence AGGACGCTCAGCCCTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197814245_1197814250 0 Left 1197814245 X:130480357-130480379 CCTGGCTCACCCACCTCAGGGGC No data
Right 1197814250 X:130480380-130480402 AGGACGCTCAGCCCTGAGCCAGG No data
1197814240_1197814250 9 Left 1197814240 X:130480348-130480370 CCAAGGCACCCTGGCTCACCCAC No data
Right 1197814250 X:130480380-130480402 AGGACGCTCAGCCCTGAGCCAGG No data
1197814247_1197814250 -9 Left 1197814247 X:130480366-130480388 CCCACCTCAGGGGCAGGACGCTC No data
Right 1197814250 X:130480380-130480402 AGGACGCTCAGCCCTGAGCCAGG No data
1197814243_1197814250 1 Left 1197814243 X:130480356-130480378 CCCTGGCTCACCCACCTCAGGGG No data
Right 1197814250 X:130480380-130480402 AGGACGCTCAGCCCTGAGCCAGG No data
1197814248_1197814250 -10 Left 1197814248 X:130480367-130480389 CCACCTCAGGGGCAGGACGCTCA No data
Right 1197814250 X:130480380-130480402 AGGACGCTCAGCCCTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197814250 Original CRISPR AGGACGCTCAGCCCTGAGCC AGG Intergenic
No off target data available for this crispr