ID: 1197814251

View in Genome Browser
Species Human (GRCh38)
Location X:130480390-130480412
Sequence GCCCTGAGCCAGGTCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197814247_1197814251 1 Left 1197814247 X:130480366-130480388 CCCACCTCAGGGGCAGGACGCTC No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data
1197814240_1197814251 19 Left 1197814240 X:130480348-130480370 CCAAGGCACCCTGGCTCACCCAC No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data
1197814248_1197814251 0 Left 1197814248 X:130480367-130480389 CCACCTCAGGGGCAGGACGCTCA No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data
1197814249_1197814251 -3 Left 1197814249 X:130480370-130480392 CCTCAGGGGCAGGACGCTCAGCC No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data
1197814245_1197814251 10 Left 1197814245 X:130480357-130480379 CCTGGCTCACCCACCTCAGGGGC No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data
1197814243_1197814251 11 Left 1197814243 X:130480356-130480378 CCCTGGCTCACCCACCTCAGGGG No data
Right 1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197814251 Original CRISPR GCCCTGAGCCAGGTCTGCTG TGG Intergenic
No off target data available for this crispr