ID: 1197836281

View in Genome Browser
Species Human (GRCh38)
Location X:130697211-130697233
Sequence CTAGGTGTCCAGGTATATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197836281 Original CRISPR CTAGGTGTCCAGGTATATAT AGG (reversed) Intronic
904005005 1:27358978-27359000 ATAGGTGTTGAGGTATATTTTGG - Intronic
910874893 1:91869167-91869189 CTAGGTGTCCAAGTTTAACTTGG - Intronic
911649445 1:100370618-100370640 GTAGGTGTACAGGTTTATTTCGG + Intronic
912230255 1:107784815-107784837 ATAGGTGTCCAGATATGTAAAGG + Intronic
913663947 1:121030479-121030501 CTAGGAGTGCAGGTATTTAGAGG - Intergenic
915907953 1:159892987-159893009 CTAGGTGTCCCTGTTTACATAGG + Intronic
920649896 1:207829301-207829323 TCAGGTGTCCAGATACATATAGG + Intergenic
920798865 1:209168315-209168337 CTTGGTGTCCAGGTCTTTATTGG - Intergenic
1072792365 10:98327469-98327491 CTAGGTGTGGATGTTTATATAGG - Intergenic
1077038972 11:509440-509462 GAAGGTGCCCAGGTATGTATAGG + Intergenic
1077970794 11:7187884-7187906 GTCAGTGTACAGGTATATATTGG + Intergenic
1079325728 11:19489889-19489911 ATATGTGTCCAGCTAAATATTGG - Intronic
1080502627 11:32885266-32885288 CTGGGGTTCCAGGTTTATATGGG - Intergenic
1081075719 11:38670941-38670963 CTAGGTCTCCAGGTGAACATAGG - Intergenic
1082006943 11:47424649-47424671 CTGGGAGTCCAGGTCAATATTGG + Exonic
1088802280 11:113317179-113317201 CTAAGTGTCCATGTAGATGTGGG - Intronic
1092911580 12:13149869-13149891 TAAGGTGTCCAGCTATGTATTGG + Intergenic
1096766892 12:53898478-53898500 CTAAGTGGCCATGTTTATATTGG + Intergenic
1097687744 12:62707042-62707064 CTAGGTGCCCAGTTTTCTATAGG + Intronic
1098105149 12:67061989-67062011 CTTGGTGACCAGGTAAATGTCGG - Intergenic
1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG + Intergenic
1100212138 12:92408624-92408646 ATGTGTGTCCAGGAATATATTGG - Intergenic
1101457463 12:104850461-104850483 CTAGGTATCCGGCAATATATAGG - Intronic
1102671962 12:114627520-114627542 GTAGGTATACAGGTAGATATAGG - Intergenic
1102671976 12:114627688-114627710 GTAGGTATACAGGTAAATATAGG - Intergenic
1106926203 13:34615625-34615647 ATAGGTGGCCAGGTAAATCTTGG - Intergenic
1108569667 13:51736807-51736829 TTAGATGTGTAGGTATATATCGG + Intronic
1111227155 13:85288857-85288879 CTAGGCCTCCAGGCCTATATGGG + Intergenic
1114357967 14:21935239-21935261 GTAGTTGTTCATGTATATATGGG - Intergenic
1118128998 14:62941113-62941135 CCAGGTGTTCTGGTATACATTGG - Intronic
1120826034 14:88956446-88956468 CAAGGTCTCCACCTATATATAGG + Intergenic
1123874335 15:24608345-24608367 GTAGATGTCCAGGTGTATGTGGG - Intergenic
1125780282 15:42259670-42259692 CTAGATTTCCAGGAATATTTTGG - Intronic
1130690328 15:86076746-86076768 CTTGGTGTCCAGGGTTTTATTGG - Intergenic
1136643215 16:31585780-31585802 GTATGTGTCCAGGAATTTATTGG + Intergenic
1137690920 16:50426985-50427007 TTAGGTGTCCAGGCATGGATGGG + Intergenic
1138197787 16:55066034-55066056 TTGGTTGTCCATGTATATATGGG - Intergenic
1140272220 16:73477555-73477577 GTAGGTGTGCAGGAAAATATTGG - Intergenic
1146843004 17:36167810-36167832 CCAGGTGTCCAGATATACACAGG + Intronic
1146855308 17:36255751-36255773 CCAGGTGTCCAGATATACACAGG + Intronic
1146865312 17:36332624-36332646 CCAGGTGTCCAGATATACACAGG - Intronic
1146871214 17:36379662-36379684 CCAGGTGTCCAGATATACACAGG + Intronic
1146878574 17:36430744-36430766 CCAGGTGTCCAGATATACACAGG + Intronic
1147101569 17:38183790-38183812 CCAGGTGTCCAGATATACACAGG + Intergenic
1148094824 17:45045058-45045080 CTAGGTATCTAGATATCTATAGG + Intronic
1148094827 17:45045090-45045112 CTAGGTATCTAGATATCTATAGG + Intronic
1150041897 17:61871621-61871643 GTAGGTGTCCCAGTAAATATTGG + Intronic
1155609608 18:27650590-27650612 CTACATGTCTAGATATATATTGG - Intergenic
1157024027 18:43821407-43821429 CTAGTTGTCCATATATATAACGG - Intergenic
1159479668 18:68972409-68972431 CTAGGTTTCCAGGAATATTAGGG + Intronic
925473724 2:4189852-4189874 CTGGATGTCCAGGCATAAATTGG - Intergenic
927254978 2:21033288-21033310 TGAGGTGTCCAGGTATCTAATGG - Exonic
927397168 2:22665835-22665857 CCAGTTGTCCATGTATATATAGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929347366 2:40902075-40902097 CTACATTTCCAGGAATATATGGG - Intergenic
937482256 2:122274602-122274624 ATAGGTGTATAGGTATATGTGGG - Intergenic
938384643 2:130855574-130855596 CTTGGTGCCCAGGTTTTTATTGG + Intronic
939811618 2:146839716-146839738 CTTGGTGTCCAGGATTTTATTGG - Intergenic
941069487 2:160939835-160939857 CAAGGTGTCAAGGTGTATTTTGG - Intergenic
947045748 2:225981279-225981301 CTAGATTTCCAGGGATATATTGG - Intergenic
947491549 2:230599753-230599775 CTAGTTGACCATGTATATATGGG - Intergenic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1172498265 20:35404949-35404971 CTAGATGCCCAGGAATATATTGG - Intronic
1177295225 21:19165049-19165071 CTTGGTGTCCAGAGATCTATAGG + Intergenic
1180018931 21:45107534-45107556 CTAGATTTCCATCTATATATGGG - Intronic
1180734582 22:18006431-18006453 CTAAGTGTCCAGTTATTTCTGGG - Intronic
1181579408 22:23819282-23819304 CTGGGTGTGCAGGTATCTGTTGG + Intronic
949801522 3:7909672-7909694 CTAGGTGTCCATGCATAAGTAGG - Intergenic
952622590 3:35363467-35363489 GTGGGTGTCCTGGTGTATATCGG + Intergenic
952705624 3:36374704-36374726 CTAGATGTGCATGCATATATGGG - Intergenic
953457018 3:43051546-43051568 CTAGATTTCCAGGAACATATTGG + Intronic
955510894 3:59679371-59679393 CTAGGTTTCCAGGTGTTTCTAGG + Intergenic
958889984 3:99772584-99772606 TTAGGTTTACAGGAATATATGGG - Intronic
959332194 3:105020656-105020678 CTGGGTGTTCAGGTATTTATGGG - Intergenic
959401349 3:105905873-105905895 CTATATATGCAGGTATATATAGG - Intergenic
960023988 3:112988026-112988048 CTAGGTGTCGGGGTTTTTATAGG + Intergenic
963837007 3:150067958-150067980 CTTGGTGTCCAGGTGGATGTTGG + Intergenic
965147931 3:164929938-164929960 CTAGTTGTTCATGAATATATGGG - Intergenic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
970946161 4:21694248-21694270 TTAGGTGTACAAGAATATATTGG + Intronic
975386649 4:73766983-73767005 CCAGATGTCCAATTATATATTGG - Intergenic
976787020 4:88833328-88833350 CAGGGTGTGCAGGTTTATATAGG - Intronic
980508483 4:133755106-133755128 CTAGGATTCCAGGTATTTTTTGG + Intergenic
982589957 4:157295795-157295817 TTAGGTTTCCAGGTAAAAATTGG - Intronic
983742839 4:171156728-171156750 CTAGGTTTTCAGTTATGTATTGG - Intergenic
984187168 4:176559551-176559573 CTAGGTTTCCAGGTTAAGATTGG - Intergenic
987316404 5:16728673-16728695 CAGGGTCTCCAGGTATATAATGG - Intronic
989510103 5:42276511-42276533 TTATGTATTCAGGTATATATAGG + Intergenic
990750038 5:59004783-59004805 CTAGATGTCCTGGGATACATGGG - Intronic
993390209 5:87311689-87311711 CTTGGTGTCCAGGGATCTTTTGG + Intronic
993924544 5:93850406-93850428 GTAGGTGTGCAGGTATGTACAGG + Intronic
994570153 5:101505351-101505373 CTAGATTTCCAAGGATATATGGG + Intergenic
996540176 5:124623255-124623277 CAATGTGTCAAGGTATATTTAGG + Intergenic
1003374350 6:5561773-5561795 CTAGGTTTCCTGTTGTATATTGG + Intronic
1004851561 6:19704796-19704818 CTAGGTGACCAGGGATACCTTGG - Intergenic
1005455193 6:26013028-26013050 GTATGTGTCTTGGTATATATAGG - Intergenic
1006639200 6:35480356-35480378 CTAGGTGTCCAGCCACATACAGG - Exonic
1009245301 6:61230614-61230636 CTAGATTTCCAGATATATGTTGG - Intergenic
1015993561 6:138974457-138974479 CTATGTGTCCAGGTGTTTAGGGG + Intronic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1024435986 7:49355026-49355048 CTTGGTTTCCAGGTAAAGATCGG + Intergenic
1028637496 7:93005923-93005945 CTAGGTGGTCAGGAATGTATGGG + Intergenic
1028716269 7:93973671-93973693 CCAGGTGTTGAGGTATACATGGG - Intronic
1031068193 7:117131371-117131393 CTAGGTTTGCAGGTAAATTTGGG + Intronic
1041773415 8:61497422-61497444 CCTGGTGTCCAGGTTTTTATTGG + Intronic
1043648850 8:82561235-82561257 CAAAGTGTCTGGGTATATATAGG - Intergenic
1048187541 8:132255473-132255495 CTAGGTTCCCAGGAATATGTAGG - Intronic
1056964067 9:91151747-91151769 CTTGGTGAGCAGGTAAATATGGG - Intergenic
1058901322 9:109444854-109444876 CTAGGTTTCCATGTGTATAAGGG + Intronic
1062583204 9:137237266-137237288 CTAGGTGTCCAGTTACCCATTGG - Intergenic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1188098967 X:26058535-26058557 CTAGGTGTACAGGTTTGTAGTGG + Intergenic
1194958068 X:100204256-100204278 CTAGCTGTCCAGGGAACTATTGG + Intergenic
1197836281 X:130697211-130697233 CTAGGTGTCCAGGTATATATAGG - Intronic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic