ID: 1197837567

View in Genome Browser
Species Human (GRCh38)
Location X:130711855-130711877
Sequence AGCCAGGCCAGCCCTCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197837567 Original CRISPR AGCCAGGCCAGCCCTCCAGA TGG Intronic
900427765 1:2588217-2588239 AGCCAGCCCAGCCCACCGGCAGG - Intronic
900477362 1:2882257-2882279 ACCCAGGCCAGCTCTCTAGAGGG + Intergenic
900944077 1:5819836-5819858 AGCCAGGCCAGCCCTGCTGGAGG - Intergenic
901380854 1:8873080-8873102 AGCCAGGGCAGCTTTCAAGAAGG - Intronic
901638863 1:10683129-10683151 AGCCAAGCCAGAACCCCAGATGG - Intronic
901974501 1:12933402-12933424 AGTCAGGCCGTCCCTTCAGATGG + Intronic
902010670 1:13268365-13268387 AGTCAGGCCGTCCCTTCAGATGG - Intergenic
903023485 1:20410836-20410858 AGCCAGCCCAGGACTCCAGCAGG + Intergenic
903173946 1:21569749-21569771 AGCTAGGCCAGGCCTGGAGAGGG - Intronic
903677270 1:25072346-25072368 GGCCAGGCCAGCTGCCCAGAAGG - Intergenic
904412374 1:30332244-30332266 CGCCAGGCCAGCCCTGAGGACGG + Intergenic
904617873 1:31759763-31759785 AGCCAGGCCTGTCCTCCTGGGGG + Intronic
904924815 1:34039197-34039219 GGCCAGGCCTGACCTCCACAGGG - Intronic
906157269 1:43621003-43621025 ACCCACCCCAGCCCTCCAGGGGG - Intronic
907241803 1:53085118-53085140 GGCCAGGCCAGCAGTCCTGAAGG - Exonic
908403910 1:63795139-63795161 AGCCAGGCTGGTGCTCCAGAGGG + Intronic
912547066 1:110458408-110458430 AGCCAGGCCAGGCCCCCACAGGG + Intergenic
915473568 1:156139567-156139589 TGCCAGGCCAGCCTCCGAGAGGG + Exonic
915581454 1:156815502-156815524 AGGCAGCACAGCCTTCCAGATGG + Intronic
916694537 1:167221719-167221741 AGCCAGGCCTGCTCTCTAGGTGG + Intronic
918181074 1:182086402-182086424 AACCAGGCCAGCCATCCAGTGGG - Intergenic
919780731 1:201219118-201219140 AGGCAGGCCAGCCCCCAAGCTGG + Intronic
920210943 1:204327744-204327766 AGACAGCCCAGGCCTCCAAAAGG + Intronic
920385678 1:205568990-205569012 AGCCCGGCCGGCCCTCCCGCGGG + Exonic
920572741 1:207030285-207030307 ATACAGGGCAGCCCTCCACAGGG + Intronic
920695156 1:208176211-208176233 AGACAGGTAAGCCCTGCAGAGGG + Intronic
920817649 1:209349887-209349909 AGCCAGGCCAGGCCTAGAGGAGG - Intergenic
922718438 1:227888509-227888531 GCCCAGGCCTCCCCTCCAGAGGG + Intergenic
923563735 1:235061140-235061162 AGCCAGCACAGCCTCCCAGATGG + Intergenic
1062992400 10:1832687-1832709 GGCCAGCCAAGCCCTGCAGAGGG - Intergenic
1064418387 10:15169097-15169119 ACCCTGGCCAGCCCTGCACAGGG + Intergenic
1065367245 10:24948854-24948876 AGCCAGACCAGTCCTACAGATGG + Intronic
1065746141 10:28844310-28844332 GGCCAGAGCAGTCCTCCAGATGG + Intergenic
1066656921 10:37705078-37705100 AGCCAGCCAAGCCCTACACAAGG - Intergenic
1069870214 10:71528476-71528498 TGCAAGGCCAGCCGTGCAGAAGG - Intronic
1069908882 10:71748095-71748117 AGTCAGGCCAGCCCTGGGGAAGG + Exonic
1070651527 10:78240264-78240286 TGCCAGGCCAGCCTCCGAGATGG - Intergenic
1072721136 10:97781693-97781715 AGCCAAGCCAGCCGGCCACAGGG - Intergenic
1073452970 10:103620288-103620310 CGCCTGGCCAGCCCTCCCCAGGG - Intronic
1074321215 10:112404538-112404560 AACCAAACCAGCCCTACAGATGG + Exonic
1074698796 10:116075079-116075101 AGTAAGGCCAGCCCATCAGAAGG - Intronic
1075144540 10:119872414-119872436 GGCCACGCGAGCCCTCGAGATGG + Intronic
1075395634 10:122125010-122125032 AGCCAGCGCAGCCCTGCAGCTGG + Intronic
1075514225 10:123096464-123096486 TATCAGGCCAGCCCTGCAGAGGG - Intergenic
1075780884 10:125016350-125016372 AGCCAGGGCGGCCATCCAGAGGG - Intronic
1075927637 10:126266134-126266156 AGCCAGGCCAGCCAAACAGGTGG + Intronic
1079475464 11:20825034-20825056 AGCCAGGCCATTGCTTCAGAGGG + Intronic
1080501004 11:32870881-32870903 AGGCAGGCTAGACCACCAGAGGG + Intergenic
1084043305 11:66555126-66555148 GGCCAGGCCATCCTTCCAGCTGG - Exonic
1084151862 11:67291378-67291400 AGCCAGCCCAGCCCTTCATCAGG - Intronic
1084456530 11:69271000-69271022 ACCCATGCCAGCCTCCCAGATGG + Intergenic
1084658870 11:70535713-70535735 ACCGAGGCCAGCCCTGCAGCAGG + Intronic
1085298096 11:75442316-75442338 AGCCAGGCCAGGGCTCCCGGGGG + Intronic
1085411077 11:76291078-76291100 GGCCAGGGCAGCCATCCAGGGGG - Intergenic
1085764553 11:79271573-79271595 GGCAGGGCCAGCCCTCCTGAGGG + Intronic
1087881373 11:103419541-103419563 AGTCAGGCCACCCTTCCACAAGG - Intronic
1088112416 11:106277691-106277713 TCCCAGACCAGCCCTACAGAAGG + Intergenic
1089616833 11:119699528-119699550 AGCCGTGCCTGCCCGCCAGAGGG - Intronic
1090257421 11:125295040-125295062 TGTCTGGCCAGCCCTCCAGAAGG - Intronic
1092140596 12:6180710-6180732 AGCCAGGCCTGCCCCGCAGTGGG - Intergenic
1096648949 12:53052670-53052692 GGGCTGGCCAGCCCTCCAGAAGG - Intronic
1097686058 12:62691859-62691881 AGCCAGTCCAGCCTCCCAGCAGG - Intronic
1100717272 12:97319152-97319174 GCCCAGGCCAGCCCTACTGAAGG + Intergenic
1101733334 12:107444353-107444375 AGCCAGGCCTGCCATACAGTGGG - Intronic
1103467045 12:121150046-121150068 AGCCATGTCACCCCTCCAGGTGG - Intronic
1104549781 12:129745914-129745936 AGCCACCCCAGCCCTTCGGAAGG + Intronic
1104838867 12:131810801-131810823 GGCCAGGTCAGCCCCCAAGAAGG + Intergenic
1109379078 13:61535058-61535080 AGCCAGGCAAACCCAGCAGACGG + Intergenic
1112077236 13:95928312-95928334 CGCCAGGCCAGCCGTCCCGTCGG - Intronic
1113434519 13:110279827-110279849 AGACAGGCCAGCACTGCAGAAGG - Intronic
1113902922 13:113806517-113806539 TTCCAGGCCAGACCTCCAGCAGG - Intronic
1113950980 13:114070556-114070578 AGCCCGCACAGCCCTCCAAATGG + Intronic
1114637388 14:24195575-24195597 AGCTGGGCCGGGCCTCCAGATGG - Intronic
1115017333 14:28633419-28633441 TTCCAGGCCAGCCCTCTAAAGGG + Intergenic
1115193134 14:30768506-30768528 AGTGAGGCCAGCCAACCAGATGG - Intergenic
1115688912 14:35824701-35824723 CGCCAGGCCAGCCTCCCGGACGG - Intergenic
1116431719 14:44853968-44853990 AGCCAGCACAACCCTTCAGAAGG + Intergenic
1116756704 14:48957676-48957698 ACTCAGGCCGCCCCTCCAGAGGG + Intergenic
1118900668 14:69982775-69982797 ACCCAGCCCAGCCCACCTGATGG - Intronic
1119660924 14:76451055-76451077 AGCCCTCCCTGCCCTCCAGAAGG - Intronic
1119718239 14:76873761-76873783 AGCCAGTCCAGCCTGGCAGAGGG - Intergenic
1121314285 14:92951917-92951939 GGCCAGGCCATCCCAGCAGAGGG + Intronic
1122122244 14:99560845-99560867 AGCCAAGCCATCTCTGCAGAAGG + Intronic
1122272663 14:100575332-100575354 AGCGATGCCAGCCCTTCACAGGG - Intronic
1122504476 14:102222848-102222870 AGCCAGGCCAGTTCTCCAGGTGG + Intronic
1122820706 14:104343394-104343416 AGCAAGACCAACCCTCCAGCTGG + Intergenic
1122901354 14:104783594-104783616 CGCCAGGCCCTCACTCCAGACGG + Intronic
1123032508 14:105458581-105458603 ACACAGGCCTGCCCCCCAGAAGG - Intronic
1123045615 14:105512274-105512296 AGCCAGTGCAGCCCTACAGCTGG + Intergenic
1123417199 15:20102649-20102671 AGCCAGGCAAGCCTGCCAGCCGG - Intergenic
1123447378 15:20340914-20340936 AGCTAGGCCAGCCAGCCAGCCGG + Intergenic
1123526475 15:21109503-21109525 AGCCAGGCAAGCCTGCCAGCCGG - Intergenic
1124596689 15:31097189-31097211 ATCCAGGCCTGCCCTCCAGTGGG + Intronic
1125578560 15:40770595-40770617 AGCCAGGCCAGCACAGCAGGTGG + Exonic
1125884829 15:43220790-43220812 AGCCAAGCCAGCGCTCGACAGGG - Exonic
1128565387 15:68697706-68697728 AGGCAGGCCAGGGCTGCAGAAGG + Intronic
1128606044 15:69037365-69037387 ACCCAGTCCAGCCCTCCAGGAGG + Intronic
1128682551 15:69662369-69662391 AGCCAGGCAAACCCACCAGTTGG + Intergenic
1129387704 15:75204953-75204975 AGTCAGGGCAGCCCAGCAGATGG - Intronic
1129405385 15:75313600-75313622 AGCCTGCCCAGGGCTCCAGAGGG + Intergenic
1129677625 15:77640989-77641011 AGGCAGGTCAGACATCCAGAAGG + Intronic
1130210019 15:81914309-81914331 AGGGAGGCCCTCCCTCCAGAAGG - Intergenic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1131385788 15:92005800-92005822 AGACAGGCCATCCCTACAAAAGG - Intronic
1133222186 16:4323519-4323541 TGCCAGGCCGGCCCTGCAGCTGG + Intronic
1133997877 16:10761983-10762005 AGCCAGACCCACCCTCCAGCTGG + Intronic
1134597069 16:15504202-15504224 AGCCAGGCCAGCCCTTGAAGAGG - Intronic
1137731421 16:50693442-50693464 AGCCTGGCCAGCCCTGGAGCCGG + Intergenic
1139178594 16:64718840-64718862 AGGCAGCCTAGCCCTCCAGCAGG + Intergenic
1139278436 16:65749392-65749414 ATCCAAGACAGCCATCCAGAGGG - Intergenic
1139279625 16:65759264-65759286 GGCCAGCCCTGCCCTCCTGAAGG + Intergenic
1139355793 16:66366528-66366550 AGCCAGCCCAGCCCTCACAAAGG + Intergenic
1140071753 16:71656594-71656616 AGCCAGTCCATGGCTCCAGAAGG + Exonic
1140486161 16:75295264-75295286 TTTCTGGCCAGCCCTCCAGAAGG - Intronic
1141314995 16:82953772-82953794 AGCCAAGACAGGCTTCCAGATGG + Intronic
1142178993 16:88658129-88658151 AGCAAGGTCAGCCCTGCTGAGGG + Intronic
1203138689 16_KI270728v1_random:1746420-1746442 AGCCGGGCAAGCCCACCAGCCGG + Intergenic
1203139064 16_KI270728v1_random:1748079-1748101 AGCCAGCCAAGCCGGCCAGACGG + Intergenic
1142473590 17:177165-177187 AGCCAGGCCGGCACTGCAGGGGG + Intronic
1144630097 17:16867008-16867030 TGCCAGCCCTGCCCTCCTGAGGG - Intergenic
1144651278 17:17008788-17008810 TGCCAGCCCTGCCCTCCTGAGGG + Intergenic
1144958661 17:19032737-19032759 AGCCAGGCCAGCCCGCCTGGCGG + Intronic
1144976498 17:19141787-19141809 AGCCAGGCCAGCCCGCCTGGCGG - Intronic
1145712607 17:26991152-26991174 ACCCAGCCCAGCCCACCAAAAGG - Intergenic
1146127615 17:30241188-30241210 AGCCAGGGCCACACTCCAGAGGG + Intergenic
1146925592 17:36742674-36742696 ACCCAGGACAGCCCTCCTGAGGG - Intergenic
1147332520 17:39707162-39707184 AGCCAGGCCCTGCCTCCAGCTGG + Intronic
1147417077 17:40299873-40299895 TGCCATGTCAGCCCTTCAGATGG - Intronic
1148878213 17:50705469-50705491 AGCCTGGACAGCTGTCCAGAAGG - Intronic
1149492393 17:57094501-57094523 CGCCAGGCCAGGCCAGCAGAAGG + Intronic
1149495903 17:57117269-57117291 AGCCAGGCCATAGCTCCATAGGG + Intronic
1150807973 17:68334189-68334211 GGCCAGGCCAGGCTTCCAGATGG + Intronic
1151725117 17:75878899-75878921 GGCCAGGCCAGCGCTCCGCAGGG + Intergenic
1152794170 17:82298749-82298771 AGCCAGACCAGGGCTCCAGGGGG + Intergenic
1152945556 17:83195781-83195803 GGCCAGGCCAGGCCTCCTGGTGG - Intergenic
1155036118 18:22026417-22026439 AACCAGGCTGGCCCTGCAGATGG + Intergenic
1155560698 18:27073275-27073297 AGCCAGGCCAGCATTCCAACAGG - Intronic
1156004586 18:32424920-32424942 ACAGAGGCCAGCCCTCCAAAGGG + Intronic
1156005682 18:32438369-32438391 AGCCAGGCAAGCCAGGCAGATGG - Intronic
1156659518 18:39330330-39330352 AGACATGCCATCCCTCCAGCTGG - Intergenic
1157282262 18:46353853-46353875 AGCCAGGCCACCCCACCACAAGG - Intronic
1157572365 18:48721497-48721519 AGCCAGCCCAGCCCTCCCCGGGG + Intronic
1160317336 18:77859844-77859866 GCCCAGGGCAGCCCTGCAGATGG - Intergenic
1160797426 19:952534-952556 AGTCAGGCCAACCCTCCTGGAGG + Intronic
1162128422 19:8511575-8511597 AGCCCAGCCAGCCCTCCTGGAGG + Intronic
1164902955 19:31943590-31943612 ATCCAGGCCAGCCCGGCAGAGGG + Intergenic
1165135775 19:33667479-33667501 TGCCACCCCAGCCTTCCAGAAGG - Intronic
1166662636 19:44657351-44657373 AGCCAGGCTAGGCCCCCAGAGGG + Intronic
1168317170 19:55489394-55489416 CGCCATGCCAGACCTCCAGGCGG - Exonic
925244392 2:2367427-2367449 AGCCAGGCCCGCCCCACAGATGG - Intergenic
926303315 2:11618975-11618997 CCCCAGGCCTGCCCTCCAGATGG - Intronic
927246042 2:20957946-20957968 ACCCAGCCCAGGCCTCCAGAAGG - Intergenic
927711958 2:25331788-25331810 AGCCAGGCCAGGCTTGCAGAAGG - Intronic
927997336 2:27495193-27495215 AGCGGGGCCAGCGCTGCAGAAGG - Exonic
928127992 2:28629273-28629295 AGCCAGGCAGGCCTGCCAGAGGG + Intronic
928377617 2:30788443-30788465 ATCCAGGCCAGCCTCACAGATGG - Intronic
929899149 2:45986467-45986489 AGCCAGGCTTGCCCTCCATCTGG - Intronic
931450822 2:62366381-62366403 AGCCAGGCCAGGCATGCAGGGGG - Intergenic
933181790 2:79235580-79235602 TGACAGGCCTGCCCTGCAGAAGG + Intronic
935129795 2:100253228-100253250 AGCCAGGGCAGGCCGCCAGATGG + Intergenic
936061072 2:109296075-109296097 AGCCAGGTTGGCCCCCCAGAAGG + Intronic
936095173 2:109525798-109525820 ATCCAGGACAGGCCTCCAGCAGG - Intergenic
936399130 2:112152481-112152503 AACCACCCCAGCCCTCCAGCTGG - Intronic
936462285 2:112722430-112722452 AGCCTGGACAGGCCTCCAGGAGG + Intronic
936943878 2:117913542-117913564 AGTCAACACAGCCCTCCAGAGGG + Intergenic
938152890 2:128902021-128902043 AGCCAGGCCCTCCCTCCTGCAGG + Intergenic
938378830 2:130825436-130825458 AGCCAGGCCTGCCCCTGAGATGG + Intergenic
941755801 2:169184450-169184472 AGTCAGCCCAGACCTCCAGAGGG - Intronic
944879732 2:204000419-204000441 AGCCTGGCCAGGCCCCCAGTAGG + Intergenic
946176529 2:217925450-217925472 AGCTTGCCCAGCCCTCCAAAGGG + Intronic
946252951 2:218424428-218424450 AGCCAGGCCAACTCTCCCCACGG - Intronic
947013444 2:225591110-225591132 AGCATGGCGGGCCCTCCAGATGG + Intronic
948874541 2:240819793-240819815 GGCCGGGCGAGCCCTCCCGAGGG + Intronic
1168926236 20:1581856-1581878 AGCCATGGCAGCACTCCAAAAGG - Intronic
1168930104 20:1614910-1614932 AGCCATGGCAGCACTCCAAAAGG - Intronic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1171305498 20:24102471-24102493 AGCCATGCCAGGCCAGCAGAGGG + Intergenic
1171464728 20:25319527-25319549 AGCCAGGGCAGCCCTGGAGGAGG - Intronic
1171986014 20:31661795-31661817 CTCCAGGCCTGCCCTCCAGCTGG + Intergenic
1172082184 20:32350810-32350832 GGACAGGCCAGCAGTCCAGAGGG - Intergenic
1172906506 20:38374099-38374121 ACCCAGCCCAGCCCTGCAGCTGG + Intronic
1173408892 20:42792171-42792193 AGCCATGCCACCCCTGCAGCTGG + Intronic
1173564299 20:44028171-44028193 AGCCAGGGAAGGCCTCCTGAAGG + Intronic
1175248543 20:57595685-57595707 AGCCAGGCCTGGGCCCCAGAGGG - Intergenic
1175771894 20:61629253-61629275 ACCCAGCCCAGCCCCCCAGCCGG + Intronic
1176147851 20:63573455-63573477 AGCCAGACCCTCCCTCCTGAAGG + Intronic
1176232519 20:64039461-64039483 AGCCTGGCCAGTCCTGCAGAGGG - Intronic
1178006953 21:28233010-28233032 TGCCAGCCAAGCCCTCCAGTCGG + Intergenic
1179346582 21:40563985-40564007 AGCAAGGCCAGCCATGCAAAAGG + Intronic
1179738684 21:43404300-43404322 AGCAGGGCCAGCTGTCCAGAGGG - Intergenic
1179970548 21:44834851-44834873 GTCCTGGCGAGCCCTCCAGAGGG + Intergenic
1180553627 22:16559702-16559724 AGCCAGCCAAGCCACCCAGATGG + Intergenic
1180553657 22:16559831-16559853 AGCCAGGCCACCCACCCAGCCGG + Intergenic
1180695075 22:17746787-17746809 AGCCAGGAGAGCGCCCCAGAAGG + Intronic
1180712778 22:17850962-17850984 GGCCAGGCCATCCTTCCTGATGG + Intronic
1181274987 22:21682572-21682594 AGCCAGCCCAGGCCTCTACAGGG + Intronic
1181404600 22:22673732-22673754 ACCCAGGCCAGCCCTGCTCATGG - Intergenic
1181468843 22:23125785-23125807 AGCCAGGCAAGGACTCCAGCAGG - Intronic
1181557029 22:23677082-23677104 TGCCAGGCCAGCCCTGCTGCTGG - Intergenic
1181697347 22:24600453-24600475 TGCCAGGCCAGCCCTGCTGCTGG + Intronic
1182408153 22:30156104-30156126 AGCCATGCTCGCCCTCCACATGG + Intronic
1182854052 22:33501667-33501689 CGCCAGGCCTGGCATCCAGATGG + Intronic
1183063438 22:35348924-35348946 GCCCAGCCCAGCCCTCAAGATGG + Intergenic
1183309708 22:37102826-37102848 AGCCAACCCAGCCCTAAAGAAGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184088930 22:42282494-42282516 AGCCAGGCCAGCACTGTAGCCGG + Intronic
1184105833 22:42367118-42367140 AGCAAGGTCAGGCATCCAGATGG - Intergenic
1184276768 22:43413096-43413118 AGCCAGGCCAGCCCAGCACTGGG - Intronic
1184783849 22:46662382-46662404 AGCCAGTCCCTCCCTTCAGAAGG - Intronic
1184784910 22:46666982-46667004 GGCCAGGCCAGGACTCCAGGGGG - Intronic
1184962730 22:47943506-47943528 ATCCTGGCCAGGCCTGCAGAGGG - Intergenic
1184992794 22:48182053-48182075 ACCCAGGCCAGGCCTCTTGAAGG + Intergenic
1185041783 22:48507903-48507925 GGCCAGGCCAGGGCTGCAGATGG - Intronic
1185300164 22:50075370-50075392 AGCCAGGCCTTGCGTCCAGAAGG + Intronic
950324791 3:12096415-12096437 AACCAGTCCAGAGCTCCAGAAGG + Intronic
950709464 3:14804319-14804341 AGCCAGGCCTGCCCTCAGAAGGG + Intergenic
952964655 3:38613658-38613680 AGCCAAGGCAACCCTCCAGAAGG - Intronic
953770602 3:45776288-45776310 AGCCAGGCCAGCCCTGATGATGG + Intronic
954003691 3:47577069-47577091 GGACAGGCCAGCCCACCAGTCGG - Exonic
954510310 3:51119139-51119161 ACCCAGGCCTGCCTTACAGAAGG - Intronic
954801037 3:53186942-53186964 AGCCAGGGCAGCCTTGCAAATGG + Intronic
954880685 3:53833905-53833927 ACCAAGGCCAGCCGGCCAGATGG - Intronic
956770538 3:72522329-72522351 GGCCAGGCCAGCACCCTAGAAGG - Intergenic
957515695 3:81248059-81248081 CCTCAGGCCAGTCCTCCAGAAGG + Intergenic
960611929 3:119562601-119562623 AGCCAGCCCAGCCCTCCCTGTGG - Intergenic
961306041 3:125959532-125959554 AGCCAGGCCAGCCGCCCCGGCGG + Intergenic
961591538 3:127985156-127985178 AGCCAGGACTACCCTGCAGATGG - Exonic
962375941 3:134858809-134858831 AGCCAGGACAGCCCCACAGTGGG + Intronic
962813325 3:138977338-138977360 AGGCAGGTCAGCGCTCCACAGGG + Intergenic
962927658 3:140010418-140010440 AGGCAGGCCAGCCCTAGAAATGG - Intronic
963046437 3:141106113-141106135 AGCCACTCCAGCCCTCTAGGTGG + Intronic
963271619 3:143291084-143291106 TGCCAGGCCAGCACTGCAGATGG + Intronic
964200694 3:154115623-154115645 TGCCAGGCCAGCCCACAAAATGG + Intergenic
965956599 3:174377764-174377786 GGCCCGGCCAGCCTTCAAGATGG - Intergenic
966298744 3:178454944-178454966 AGCCAGGCCAGCACTCCACTGGG + Intronic
966600896 3:181774078-181774100 AGCCATGCCAGGTCTCCAGCTGG - Intergenic
968802269 4:2751036-2751058 GGGCAGGCCAGCCCTGCAAAGGG + Intronic
969526723 4:7707613-7707635 AGCAAGGGCAACCCTGCAGATGG - Intronic
971198409 4:24491143-24491165 AGCAAGGCCAGCGCACCAGCTGG + Intergenic
984170815 4:176357432-176357454 AGGCAGAGCAGCCCTCCTGATGG + Intergenic
984966566 4:185144858-185144880 GGCCAGGTTACCCCTCCAGAAGG - Exonic
985209060 4:187572544-187572566 AGCCAGGGCTGCCCTTCAGTGGG - Intergenic
986104456 5:4646296-4646318 AGCCAGGTCTGCCCCACAGACGG + Intergenic
986107735 5:4675970-4675992 GGCCACGCCAGCCCACCAGTGGG - Intergenic
987429222 5:17811515-17811537 ATCCAGACCAAACCTCCAGAGGG + Intergenic
990273881 5:54175017-54175039 AGTCAGGCCAGCCCTCCTCCAGG - Intronic
990304625 5:54482205-54482227 AGCCAAGGCAGCCCCCCAGAAGG + Intergenic
990311431 5:54542574-54542596 GGCTAGGCCAGCCCTCATGAGGG + Intronic
991418284 5:66414146-66414168 ATCCTGGCCAGCTGTCCAGATGG - Intergenic
992116703 5:73545241-73545263 AGCCAGGCCTTATCTCCAGATGG - Intergenic
993254452 5:85571545-85571567 AGCCAGGCCAGTCTTGCAAATGG + Intergenic
993415831 5:87628998-87629020 AGCCAGACCAACCCTCCATGAGG + Intergenic
995578938 5:113574195-113574217 AGTCAGGCCAGTCTTCCATAGGG + Intronic
996439905 5:123478535-123478557 AGCCAGGCCAGCCTTGATGAGGG + Intergenic
997195410 5:131975726-131975748 AGCCAGGGGAGCCCTGCACAAGG + Intronic
998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG + Intronic
998960337 5:147479722-147479744 AGCAAGGCCAGCTTCCCAGATGG + Intronic
1002518181 5:179774595-179774617 GGCCAGGCAAGCCCTGCTGAGGG - Exonic
1002571725 5:180143389-180143411 AGGAAGGCCAGCCCTGAAGATGG + Intronic
1004426311 6:15509589-15509611 AGCCGGGCCAGGCCACCAGCTGG + Intronic
1005624689 6:27652711-27652733 GGCCCGGCCAGCCTTCAAGATGG + Intergenic
1006382725 6:33709726-33709748 AGCCAAGCCAGCCCACCTAAAGG - Intronic
1006802809 6:36770109-36770131 AGCCAAGCCAGCCTTCCGGTGGG - Intronic
1006807748 6:36799539-36799561 AGCCAGGCCACCTCTGCAGGCGG + Intronic
1006934617 6:37708678-37708700 TGCCTGGCCAGACCTCCAGGAGG - Intergenic
1010160901 6:72853635-72853657 AGCCAGGGCTGCCCCACAGAAGG - Intronic
1010741357 6:79509062-79509084 AGCCAGCGCAGCCCACCTGAGGG - Intronic
1015004355 6:128260518-128260540 AGAGAGGCCAGCCATCCAGAAGG + Intronic
1016779388 6:147941380-147941402 ATACAGCCAAGCCCTCCAGAGGG - Intergenic
1019262284 7:88311-88333 AGCCAGGCCTGGCCTCCTGGAGG + Intergenic
1019655945 7:2195813-2195835 AGGCAGGTCAGCCCTCCAGCAGG + Intronic
1022250100 7:28598705-28598727 AGCCAGGCCAACTCAACAGAGGG - Intronic
1023550975 7:41369671-41369693 AGGCTGGACTGCCCTCCAGAAGG + Intergenic
1025210289 7:57016461-57016483 ACCCAGGCCAGACCACAAGAAGG - Intergenic
1025661666 7:63560386-63560408 ACCCAGGCCAGACCACAAGAAGG + Intergenic
1026794896 7:73359796-73359818 AGCACGCCCAGCCCTCGAGAAGG - Intergenic
1029224254 7:99013727-99013749 AGCCAGGCCTGCCCTCGTGTGGG + Intergenic
1032945827 7:136851496-136851518 AGCCAGGATAGGCCTCCACACGG + Intergenic
1033411065 7:141118251-141118273 AGACAGGCCAGGCTTCCAAAAGG - Intronic
1033660554 7:143399211-143399233 ATCCAGCCCCTCCCTCCAGATGG + Intronic
1034052764 7:148000285-148000307 ACCTATGCCTGCCCTCCAGAGGG + Intronic
1034908948 7:154976093-154976115 AGCCCTGCCAGCTCTCAAGAAGG - Exonic
1034959356 7:155355398-155355420 CCCCAGGCGAGCCCCCCAGAGGG + Intergenic
1035084768 7:156248591-156248613 CGCCTGCCCTGCCCTCCAGATGG + Intergenic
1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG + Intergenic
1043890086 8:85644478-85644500 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043891661 8:85656530-85656552 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043891697 8:85656668-85656690 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043892733 8:85663367-85663389 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043895475 8:85735284-85735306 AGCCAGGCCGGTGCTCCCGAAGG + Intergenic
1043895511 8:85735422-85735444 AGCCAGGCCGGTGCTCCCGAAGG + Intergenic
1043897168 8:85746386-85746408 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043897204 8:85746524-85746546 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043899494 8:85764754-85764776 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043899530 8:85764892-85764914 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043901102 8:85776947-85776969 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043901138 8:85777085-85777107 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043903066 8:85792222-85792244 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043903102 8:85792360-85792382 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043904675 8:85804415-85804437 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043904711 8:85804553-85804575 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043906288 8:85816606-85816628 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043906324 8:85816744-85816766 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1043907862 8:85828658-85828680 AGCCAGGCCGGTGCTCCCGAAGG - Intergenic
1047169287 8:122475334-122475356 TGCCAGGCTTGCCCTCCCGAGGG - Intergenic
1049843855 8:144790415-144790437 CGCCCGGCCAGCCTTCAAGATGG + Exonic
1050430859 9:5560340-5560362 AGCTAGGTTAGTCCTCCAGAGGG + Intronic
1050703160 9:8364538-8364560 AGCCAGGCTAGCACTCCAACGGG + Intronic
1051072313 9:13186273-13186295 AGCCAAGTCAGCCCTGAAGAGGG + Exonic
1053556676 9:39145213-39145235 ATTCAGGCCAGGCCTCCAGAAGG - Intronic
1053820787 9:41965491-41965513 ATTCAGGCCAGGCCTCCAGAAGG - Intronic
1054089655 9:60833630-60833652 ATTCAGGCCAGGCCTCCAGAAGG - Intergenic
1054111066 9:61109188-61109210 ATTCAGGCCAGGCCTCCAGAAGG - Intergenic
1054609791 9:67221937-67221959 ATTCAGGCCAGGCCTCCAGAAGG + Intergenic
1055617816 9:78091328-78091350 GGCCACTCCTGCCCTCCAGAAGG - Intergenic
1056236679 9:84601458-84601480 AGTTAGGGCAGCCATCCAGAAGG + Intergenic
1056740445 9:89249929-89249951 AGCCAGGCCAGTTCTGCAGGAGG - Intergenic
1056969644 9:91191661-91191683 AGCCAGGCAAGCTCTCTGGACGG + Intergenic
1057210841 9:93200218-93200240 AGCAAGGCCAGGCCTCGAGGAGG - Intronic
1060300037 9:122369759-122369781 AGCCAGGGCAGACCTGGAGAAGG - Intergenic
1061271582 9:129546767-129546789 TGCCAGGCCAGCCCTACACTAGG - Intergenic
1061500977 9:131001699-131001721 AGGCATGCCAGCCCCGCAGAGGG - Intergenic
1061618874 9:131797992-131798014 AGCCAGGCAGGCCCTCCAATAGG - Intergenic
1062206163 9:135338605-135338627 ACCCAGGTCAGCGCTCCAAAGGG + Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1062465187 9:136677737-136677759 AGGCAGGGCAGCCGTCCAGGTGG - Intronic
1062617924 9:137406555-137406577 AGCCAAGTCCACCCTCCAGACGG - Intronic
1203364433 Un_KI270442v1:244247-244269 ACCCAGGCCGGCGATCCAGAGGG - Intergenic
1186428646 X:9485586-9485608 AGCCCGGCCATCCCATCAGAAGG - Intronic
1189688110 X:43586960-43586982 AGCCTTGCCAGCCCTCAGGAAGG + Intergenic
1190916150 X:54812535-54812557 AGCCAGGCCAGGCACCCAGTAGG - Intronic
1191974742 X:66859707-66859729 TGCCAGGCCTGCCTTCCTGAAGG + Intergenic
1192266141 X:69539146-69539168 TGCCAGGCCAGTGCTCCAGGAGG - Intergenic
1195861346 X:109386631-109386653 AACCAGGAAAACCCTCCAGATGG + Intronic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1198057015 X:133005515-133005537 AGCCAGGCCAGCCTTCATGAAGG - Intergenic
1199700535 X:150372310-150372332 ACCCAGCCAAGCCCTCCACAGGG - Intronic