ID: 1197839965

View in Genome Browser
Species Human (GRCh38)
Location X:130735786-130735808
Sequence GATTACATCATCATTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197839965_1197839966 19 Left 1197839965 X:130735786-130735808 CCAGTAGGAATGATGATGTAATC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1197839966 X:130735828-130735850 AGATGCCAAGATACATTAATAGG 0: 1
1: 0
2: 2
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197839965 Original CRISPR GATTACATCATCATTCCTAC TGG (reversed) Intronic
901970514 1:12903941-12903963 GCTTGCATCATCTTTCCAACTGG + Intronic
904574333 1:31493550-31493572 GATTATATCCTCATTTCTTCTGG - Intergenic
904804231 1:33119720-33119742 GATTACATCATCAATGCAACGGG + Intronic
905939006 1:41848184-41848206 GATTTCATCATCATACCTGGAGG - Intronic
906229440 1:44148506-44148528 TATTACAGCATGATTTCTACAGG + Intergenic
908849754 1:68363809-68363831 GATTACAGCAGCATCCCCACCGG - Intergenic
910658438 1:89643059-89643081 GAATATATCCTCCTTCCTACTGG - Intronic
912683397 1:111743209-111743231 GATAACCTCATCCTTCCTCCAGG - Intronic
1063746612 10:8890901-8890923 TATTACATCTTCCTGCCTACAGG - Intergenic
1064520536 10:16196339-16196361 GAATATATCATCATTCAAACTGG + Intergenic
1065530499 10:26665271-26665293 GATTGCATCATCATAAATACAGG + Intergenic
1066021700 10:31310199-31310221 GATTACCTCAGCATTTCTCCAGG - Intergenic
1067213122 10:44278506-44278528 GATTAAATCAGCATTTCTCCAGG - Intergenic
1071742440 10:88375534-88375556 GATTACAACATTATTTCTATGGG + Intronic
1077397263 11:2331103-2331125 GCTTACACCATCAGTCCTCCTGG - Intergenic
1080356214 11:31449627-31449649 AATAACATCATCATTATTACTGG - Intronic
1082763386 11:57147661-57147683 GATTCCATGATCATTCCTCCAGG - Intergenic
1089662703 11:119995977-119995999 GATGACATCTTCATGCCCACAGG + Intergenic
1090232235 11:125115949-125115971 GATTACATTAGCATTTCTACAGG + Intergenic
1093626741 12:21358839-21358861 GATTACATGTTTATTCCTTCAGG - Intronic
1095502923 12:42860266-42860288 CATCACATCATCAGCCCTACTGG + Intergenic
1096562938 12:52450057-52450079 GATTTCATCCTCATATCTACAGG + Exonic
1096565089 12:52471717-52471739 GATTTCATCCTCATATCTACAGG + Exonic
1096567101 12:52491157-52491179 GATTTCATCCTCATATCTACAGG + Exonic
1096589759 12:52649959-52649981 GATTTCATCCTCATACCTATTGG + Exonic
1096593483 12:52678208-52678230 GATTTCATCCTCATACCTGCAGG + Exonic
1099852554 12:88120435-88120457 TATTACATCATTATTATTACTGG - Intronic
1100227898 12:92577389-92577411 AATTACAAATTCATTCCTACTGG - Intergenic
1100833475 12:98541272-98541294 GCTGACATGTTCATTCCTACTGG + Intronic
1110794662 13:79622687-79622709 GATTACATCATCATTCAGCTGGG + Intergenic
1111049848 13:82867473-82867495 GATTACATAATCGTTTCTTCTGG - Intergenic
1113162905 13:107402767-107402789 GATTACATTATTATTACTTCAGG + Intronic
1117373471 14:55099904-55099926 GCTTACATGCTCATTCCTATTGG - Intergenic
1118560079 14:67069736-67069758 GATTACATCAAAATGCATACAGG - Intronic
1128348359 15:66870377-66870399 TATTTCACCATCATTCCTAAAGG - Intergenic
1129417074 15:75390329-75390351 GATTACTTCATTATTCATAAAGG - Intronic
1129798215 15:78394146-78394168 GATTCTATCCTCATTCTTACAGG + Intergenic
1130271375 15:82451396-82451418 GTATACATGAGCATTCCTACAGG - Intergenic
1130463714 15:84178737-84178759 GTATACATGAGCATTCCTACAGG - Intronic
1130488959 15:84416051-84416073 GTATACATGAGCATTCCTACAGG + Intergenic
1130500552 15:84494805-84494827 GTATACATGAGCATTCCTACAGG + Intergenic
1131383608 15:91984351-91984373 GATTCCATCATCTTTCTTATCGG + Intronic
1135481450 16:22823983-22824005 GATTTCTTCATTATTCTTACTGG + Intronic
1141670741 16:85490490-85490512 TCCTACATCATCATTCCTTCTGG - Intergenic
1147444550 17:40466873-40466895 GGTTCCATCATCATTCCTGTAGG + Intergenic
1155625098 18:27825474-27825496 AATTACATGAAAATTCCTACTGG + Intergenic
1156053206 18:32964070-32964092 AATAACATAATCATTCCTAAAGG + Intronic
1159375100 18:67582988-67583010 GCTTACGTTATCATTTCTACTGG - Intergenic
1159540928 18:69774747-69774769 GATTTAATAATCATTCCTAAAGG + Intronic
1165873690 19:38991093-38991115 GATTACATCATCATCCCTGGAGG - Intronic
928301040 2:30124105-30124127 GATTTCCCCTTCATTCCTACAGG - Intergenic
933193185 2:79359931-79359953 GATGCCATCATCATTCTTATGGG + Intronic
933505425 2:83171104-83171126 AATTACATATTCATTCATACTGG + Intergenic
940844253 2:158622939-158622961 GTTTACATGATCATTACTAAGGG - Intronic
942788513 2:179731254-179731276 CATTTGATCATCATACCTACTGG + Intronic
946558169 2:220882813-220882835 GAACAGATCATCTTTCCTACAGG + Intergenic
947024395 2:225720573-225720595 AATGACATCATCAGTCCTCCTGG - Intergenic
1168783577 20:516907-516929 GATCTCATCATCATCCCGACAGG + Intronic
1170751530 20:19152165-19152187 GAATACATCATCATTTATTCAGG - Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1174159573 20:48541334-48541356 GATGACCTCAGCATTCCTCCTGG - Intergenic
1180987723 22:19915239-19915261 GATCACATCATCATTGCTACTGG - Exonic
1182133544 22:27878606-27878628 GAATACATAATCATTCAGACAGG + Intronic
1182693773 22:32182382-32182404 AATTATAACATCATTCCTATTGG + Intergenic
949317819 3:2776208-2776230 GATTACATCATTTTCCATACAGG + Intronic
950986088 3:17368822-17368844 GATTACATAATAATTCATAATGG - Intronic
952692084 3:36220918-36220940 GATTTTATCATCATTTCTTCAGG - Intergenic
959457467 3:106580583-106580605 GATGCCATCATCTTTCCCACAGG - Intergenic
971283156 4:25259169-25259191 GATTACATCATCAGAAATACAGG + Exonic
973549057 4:52013191-52013213 GATTTCATCCTGATTGCTACTGG - Intronic
975944829 4:79693715-79693737 GATTAAAGGATCATTCCAACAGG - Intergenic
977831107 4:101594270-101594292 GATAACAATATCTTTCCTACAGG - Intronic
980620787 4:135300343-135300365 GAAAACATCATCTTTCCTATTGG - Intergenic
983246594 4:165294823-165294845 GTTCACATCATAATTCCTACAGG - Intronic
984554181 4:181194467-181194489 GATCAGAGCAGCATTCCTACTGG - Intergenic
987027146 5:13939082-13939104 GAGAATCTCATCATTCCTACAGG + Intronic
987655298 5:20798464-20798486 GATTACTTTATCATTTCTACTGG + Intergenic
988768261 5:34405438-34405460 GATTACTTTATCATTTCTACTGG - Intergenic
999519022 5:152331274-152331296 CATTACATAATCATTCCCACTGG + Intergenic
1001094313 5:168764477-168764499 GGCTAGATGATCATTCCTACAGG - Intronic
1004190395 6:13458452-13458474 GATTACATCTTCATTTCAAAGGG - Intronic
1007814527 6:44511550-44511572 GATTACTTCTTCACTCCTGCTGG - Intergenic
1012731899 6:102893702-102893724 GATGACATTATCTTTCCTTCTGG - Intergenic
1013815722 6:114095095-114095117 TATTACCTCATCAATCCTATGGG - Intronic
1016078828 6:139830969-139830991 AAGTACATCATCGTTTCTACTGG - Intergenic
1021564422 7:22002843-22002865 AATTAGAACATCATTCCTATGGG + Intergenic
1022509809 7:30927852-30927874 GATTACATCCTGCTTCCTTCTGG - Intergenic
1022918939 7:34992886-34992908 GAATACAACATTATTCATACAGG - Intronic
1030048115 7:105515274-105515296 GATTACAACATTTTTCGTACAGG - Intronic
1032971398 7:137168143-137168165 GCTCACATCATCTTTTCTACAGG + Intergenic
1035986239 8:4434955-4434977 GATTACATCATTTTTTCTATAGG - Intronic
1037377226 8:18244035-18244057 TATTACCTCATCGTTCCCACAGG + Intergenic
1041785940 8:61634361-61634383 GATTATATCAACATTCCTTTTGG + Intronic
1043274413 8:78375450-78375472 GAATACATCAGCATTCTGACTGG - Intergenic
1044941918 8:97352297-97352319 GATTCCACCAACATTCCTAATGG + Intergenic
1052428830 9:28339789-28339811 TATTAGAACTTCATTCCTACAGG + Intronic
1055585071 9:77750451-77750473 GATAACATGATCATTACTAGTGG - Intronic
1056006280 9:82274860-82274882 TCTGACATCATCATTCCTTCAGG - Intergenic
1056749587 9:89337991-89338013 TGTGACCTCATCATTCCTACAGG - Intronic
1057066876 9:92061408-92061430 GATTTCACCTTCATTCCTAAAGG - Intronic
1057871045 9:98717878-98717900 AATTATAACATCATTCCTATTGG + Intergenic
1060049585 9:120368367-120368389 GATTACATTCTCATCTCTACAGG + Intergenic
1060096874 9:120798987-120799009 AATTATATCATTATTCTTACAGG - Intergenic
1193899775 X:87163016-87163038 GATTATGTTATCATTGCTACAGG - Intergenic
1195473984 X:105263476-105263498 GATATCATCATCATACCTACAGG - Intronic
1196976268 X:121161245-121161267 GATTACATCATCCATTATACTGG + Intergenic
1197839965 X:130735786-130735808 GATTACATCATCATTCCTACTGG - Intronic
1201249200 Y:12039230-12039252 GGTTCCACCAACATTCCTACAGG - Intergenic
1201623935 Y:15992554-15992576 AATTTCATCAATATTCCTACAGG + Intergenic
1202371484 Y:24199877-24199899 GTATACATGAGCATTCCTACAGG + Intergenic
1202499301 Y:25470239-25470261 GTATACATGAGCATTCCTACAGG - Intergenic