ID: 1197841947

View in Genome Browser
Species Human (GRCh38)
Location X:130757610-130757632
Sequence TAAGTGTCCTGTCCCTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197841945_1197841947 11 Left 1197841945 X:130757576-130757598 CCACTGCTTTTCAGAATGGGGAT 0: 1
1: 0
2: 10
3: 17
4: 250
Right 1197841947 X:130757610-130757632 TAAGTGTCCTGTCCCTTAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197841947 Original CRISPR TAAGTGTCCTGTCCCTTAGG TGG Intronic
903732622 1:25507377-25507399 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
905533861 1:38703079-38703101 TCAGTGTCATGGCCCGTAGGTGG + Intergenic
906032854 1:42734606-42734628 GAACTGTCCCTTCCCTTAGGAGG + Exonic
906122471 1:43403629-43403651 TCAGTGTCCTGCCCCCTGGGTGG + Exonic
907324564 1:53628582-53628604 TTAGGTTCCTCTCCCTTAGGTGG - Intronic
911124339 1:94326577-94326599 GAAGTGTCCTCTGCCTGAGGAGG - Intergenic
916569648 1:166014013-166014035 TGAGTGTGCTGACCCTAAGGAGG - Intergenic
917385507 1:174469587-174469609 GAAGTGTCTTTGCCCTTAGGAGG + Intronic
919314683 1:195956074-195956096 TAAGTGTACTGTTCATTAAGTGG + Intergenic
921880116 1:220245950-220245972 TGAGGGTCCTGTCTCTTAGAAGG + Intronic
1063528669 10:6809354-6809376 TAAGGGTCCTCTCTGTTAGGAGG - Intergenic
1064840504 10:19586435-19586457 TGAGGGTCCTGTCCGTTAGAAGG - Intronic
1065843920 10:29729143-29729165 TAAGAGCCATTTCCCTTAGGAGG - Intronic
1066664276 10:37766557-37766579 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
1066813519 10:39372324-39372346 TGAGGGTCCTGTCTGTTAGGAGG - Intergenic
1066818397 10:39451694-39451716 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
1068050736 10:51946669-51946691 TGAGGGTCCTGTCTCTTAGGAGG - Intronic
1068474154 10:57504391-57504413 TAAGTATCCTGACTTTTAGGAGG + Intergenic
1068483099 10:57620525-57620547 TATGAGTGCTGTCTCTTAGGAGG - Intergenic
1068651409 10:59526800-59526822 TAACTCTTCTGTCACTTAGGAGG + Intergenic
1071072508 10:81710407-81710429 TGAGGGTCCTGTCTGTTAGGAGG + Intergenic
1071459399 10:85877552-85877574 TGAGTGTCCTGTCTGTTAGAAGG + Intronic
1075002383 10:118808339-118808361 TTACTGTCCTGTCCCTTGGGTGG - Intergenic
1077047358 11:552426-552448 TGTGTGTCCTGTCCCGTGGGGGG + Intronic
1077047383 11:552509-552531 TATGTGTCCTGTCCCGTGGGGGG + Intronic
1077047707 11:553695-553717 TCTGTGTCCTGTCCCTGAGAAGG - Intronic
1077654016 11:4000518-4000540 TGAGGGTCCTGTCTGTTAGGAGG + Intronic
1078308583 11:10215972-10215994 TAAGTATACTGTCCCTTCTGTGG + Intronic
1079496602 11:21051629-21051651 AAAGTGTCATGTCCCATAGATGG - Intronic
1079629073 11:22652128-22652150 TGAGGGTCCTGTCTCTTAGAAGG - Intronic
1080705822 11:34692025-34692047 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1082151871 11:48749905-48749927 TGAGGGTCCTGTCCGTTAGAAGG - Intergenic
1082714105 11:56591877-56591899 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1086440967 11:86829697-86829719 TGAGGGTCCTGTCTCTTAGAAGG - Intronic
1087754978 11:102045876-102045898 TGAGTGTTTTGTCCATTAGGAGG - Intergenic
1090892593 11:130938767-130938789 CAAGTATCCTGTCCCCGAGGTGG - Intergenic
1094451732 12:30589279-30589301 TAAGGGTCCTGTCTCTTAGAAGG + Intergenic
1094710511 12:32957101-32957123 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
1096020930 12:48325250-48325272 TGAGGGTCCTGTCCGTTAGAAGG - Intergenic
1098767482 12:74508731-74508753 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1099041070 12:77654891-77654913 TGAGGGTCCTGTCTGTTAGGAGG + Intergenic
1099106863 12:78507354-78507376 TGAGGGTCCTGTCTGTTAGGAGG + Intergenic
1100238261 12:92683408-92683430 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
1101240337 12:102832391-102832413 TGAGGGTCCTGTCCATTAGAAGG - Intergenic
1105545495 13:21347905-21347927 GAGGTGTCCTGTCTCTTTGGCGG - Intergenic
1107231274 13:38112932-38112954 TAAGGGTCCTGTCTCTTAGAAGG + Intergenic
1107507272 13:41047487-41047509 TGAGGGTCCTGACCCTTAGAAGG - Intronic
1107973658 13:45669274-45669296 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
1108168117 13:47713070-47713092 TGAGGGTCCTGTCTCTTAGAAGG + Intergenic
1108326986 13:49343480-49343502 TAAGATTCCTGCCTCTTAGGGGG + Intronic
1108491162 13:50982850-50982872 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
1108630219 13:52274851-52274873 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1109706583 13:66101457-66101479 TAAGATTCCTGTCCCATGGGAGG - Intergenic
1115124984 14:29981403-29981425 TAGGTGTTCTGTTCCTTTGGAGG + Intronic
1115348303 14:32366005-32366027 TATTAGTCCTGCCCCTTAGGAGG + Intronic
1115868194 14:37772013-37772035 TGAGGGTCCTGTCCGTTAGAAGG - Intronic
1116785231 14:49280861-49280883 AATGTTTCCTGTCCCTTAAGAGG + Intergenic
1117563134 14:56965529-56965551 TGAATGCCCTGTCCCTTGGGTGG + Intergenic
1118465947 14:66031660-66031682 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1120676253 14:87424100-87424122 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
1122602367 14:102928180-102928202 CCAGTGTCCTGTCCCTGAGCTGG - Intronic
1123068664 14:105630480-105630502 TAAGTGTCCTGTCCCTAGCCAGG - Intergenic
1123092688 14:105748807-105748829 TAAGTGTCCTGTCCCTAGCCAGG - Intergenic
1125006674 15:34824578-34824600 TAAGTATCCAGTAACTTAGGAGG - Intergenic
1127302094 15:57664841-57664863 TAACTGTCCTATGCCTTAGTTGG + Intronic
1131968618 15:97870962-97870984 TCAGTTTCCTGCCCTTTAGGGGG - Intergenic
1135487588 16:22879535-22879557 TCAGTGTCCGATCCCTGAGGTGG - Intronic
1137383449 16:48020673-48020695 TGAGGGTCCTGTCTGTTAGGAGG - Intergenic
1142538057 17:633972-633994 TAAGTTCCCTGTGGCTTAGGAGG - Intronic
1143098196 17:4489710-4489732 TGAGTGTTCTGACCCTTGGGCGG - Intergenic
1144694675 17:17294773-17294795 TAAGTGTACTGTTTCTTTGGTGG - Intergenic
1147936020 17:44011646-44011668 TGAGTCTCCTGTCCCTGAGAAGG - Exonic
1150322862 17:64231043-64231065 TATGTGTGCTGGCCATTAGGTGG + Intronic
1150879157 17:69004328-69004350 TCAGGGTCCTGTCCGTTAGAAGG - Intronic
1151032859 17:70761388-70761410 TAAGTCTCCTTTCCCAAAGGAGG - Intergenic
1151923244 17:77173574-77173596 CAAGAGTCCTGTCCCTCAGGAGG - Intronic
1152913144 17:83016877-83016899 TTAGTGACGTGCCCCTTAGGTGG - Intronic
1166433704 19:42749153-42749175 TGAGGGTCCTGTCTCTTAGAAGG - Intronic
1166921820 19:46233457-46233479 TGAGATTCCTGTCCCTTAGAAGG - Intergenic
1167412973 19:49355894-49355916 CTAGTGCCCTGTCCCTGAGGAGG - Intronic
931430558 2:62205806-62205828 TAAGCAGCCTGTCCCTCAGGTGG - Intronic
932986099 2:76728083-76728105 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
933755815 2:85637646-85637668 TAAGTGTTCTGGCCACTAGGTGG + Intronic
934557724 2:95296342-95296364 GCTGTGTCCTGTCCCTTGGGCGG - Intergenic
935675662 2:105593041-105593063 TAAGTTTCCAGCCCCATAGGTGG - Intergenic
938534991 2:132232117-132232139 TAAGGGTCCTGTCTGTTAGAAGG + Intronic
943098007 2:183453518-183453540 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
943457367 2:188124302-188124324 TGAGGGTCCTGTCTCTTAGAAGG + Intergenic
946353656 2:219171643-219171665 TGACTGTCCTGTCCCTGAGTTGG - Intergenic
1173267236 20:41495602-41495624 TAAGTGTTCTCACCCTTAGGGGG + Intronic
1173774495 20:45693036-45693058 TAAGGGTCCTGTCTGTTAGAAGG - Intronic
1179606553 21:42519459-42519481 TATAAATCCTGTCCCTTAGGAGG - Intronic
1181388865 22:22564723-22564745 TAAGTGTCCTGTCCCAGTGCTGG + Exonic
1183941993 22:41301326-41301348 AAAGTGTCCTGCCTTTTAGGGGG - Intergenic
1183947144 22:41332912-41332934 CAAGTGTCTTGGCCCTTGGGAGG - Intronic
1184720042 22:46306887-46306909 TAAGTGTCCAGGCCCTTAGCTGG + Intronic
952591821 3:34964389-34964411 TATTTGTCCTCTCCCTGAGGAGG + Intergenic
952602753 3:35104708-35104730 TGAGGGTCCTGTCTCTTAGAAGG + Intergenic
956954265 3:74318542-74318564 TGAGGGTCCTGTCCGTTAGAAGG - Intronic
957308405 3:78487960-78487982 TGAGTGTCCTGTCTGTTAGAAGG + Intergenic
957337939 3:78856596-78856618 TATGTGCCCTGACCTTTAGGTGG + Intronic
960318689 3:116208610-116208632 TGAGGGTCCTGTCCGTTAGAAGG - Intronic
961420867 3:126801996-126802018 TGAGGGTCCTGTCCGTTAGAAGG + Intronic
963691048 3:148503467-148503489 TAAGTCTCCAGTCTCTTTGGGGG - Intergenic
963736523 3:149023290-149023312 AAAGTGTCCTCCCCCTGAGGAGG + Intronic
964824505 3:160810240-160810262 TGACTGTCCTGTCCCTCAAGAGG + Intronic
967551231 3:190797662-190797684 TAAGTGGTTTGTGCCTTAGGAGG - Intergenic
968474529 4:797027-797049 TAAGTATCCTGTCCCATCTGGGG - Intronic
969068254 4:4508121-4508143 TCAGTGTCCTGTGCACTAGGGGG - Intronic
970259754 4:14212300-14212322 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
970474342 4:16407602-16407624 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
974514330 4:62889015-62889037 TGTGTGGCCTGTCCCTTATGTGG + Intergenic
975187274 4:71418901-71418923 TGAGTGTCCTGTCTGTTAGAAGG - Intronic
977957479 4:103046904-103046926 TAAGAGTTCTGTACCTAAGGAGG - Intronic
978274732 4:106935898-106935920 TGAGGGTCCTGTCCGTTAGAAGG + Intronic
979562009 4:122110886-122110908 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
980302711 4:131014644-131014666 TAATTGTCCTGTCCCAAAGGTGG - Intergenic
980898916 4:138886489-138886511 TGAGGGTCCTGTCTGTTAGGAGG - Intergenic
983341320 4:166464111-166464133 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
983377557 4:166949549-166949571 TAAGGGTCCTGTCTGTTAGAAGG - Intronic
986397408 5:7344306-7344328 TAAGAGACCTGTCCCTGAGGAGG - Intergenic
987273372 5:16336205-16336227 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
990843015 5:60104795-60104817 TGAGGGTCCTGTCTCTTAGAAGG + Intronic
991320811 5:65371056-65371078 TGAGTGTCCTGTCTGTTAGAAGG + Intronic
994973746 5:106776189-106776211 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
996431903 5:123390053-123390075 TAAGTGTCTTCTCCTTTATGGGG + Exonic
996579091 5:125010341-125010363 AAATGTTCCTGTCCCTTAGGAGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999646703 5:153724178-153724200 TGAGGGTCCTGTCTCTTAGAAGG + Intronic
1001651994 5:173322574-173322596 TAACTTTCCTTTCCCTTAGAAGG - Intronic
1003413886 6:5891416-5891438 TGAGTGTCCTGTCTGTTAGAAGG - Intergenic
1003457792 6:6299958-6299980 TGAGTGTCCTGTCTGTTAGAAGG - Intronic
1004226424 6:13788674-13788696 TAAGTGTGCTGTCTCTTCTGGGG + Exonic
1004400029 6:15279847-15279869 TCAGTCTCCTGGCACTTAGGAGG + Intronic
1007858807 6:44885548-44885570 TAAGGGTCCTGTCTGTTAGAAGG + Intronic
1009301632 6:62031389-62031411 AATTTGTCCTGTACCTTAGGTGG + Intronic
1009850054 6:69184733-69184755 TTATTTTCCTTTCCCTTAGGAGG - Intronic
1010901631 6:81434274-81434296 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
1011392920 6:86873752-86873774 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
1012951569 6:105523293-105523315 TAGGAGTCCAGTCCCTTAGGAGG + Intergenic
1013622907 6:111908205-111908227 TGAGGGTCCTGTCCGTTAGAAGG - Intergenic
1018740842 6:166727574-166727596 TTAGGGTGCTGTACCTTAGGGGG - Intronic
1018900203 6:168048013-168048035 GGAGTGTCCTGTGCCTTATGGGG + Intergenic
1029875120 7:103742198-103742220 TAAGGGTCCTGTCTGTTAGAAGG + Intronic
1030531034 7:110712219-110712241 TGAGGGTCCTGTCTCTTAGAAGG - Intronic
1031016405 7:116580946-116580968 TAAGTAACATCTCCCTTAGGTGG - Intergenic
1032973973 7:137200660-137200682 TAAGAGTTAGGTCCCTTAGGAGG + Intergenic
1032994032 7:137425331-137425353 TAAGGGTCCTGTCTGTTAGAAGG + Intronic
1034089542 7:148351295-148351317 TAAGTGCCGTGTCCTTGAGGAGG - Intronic
1034382209 7:150707034-150707056 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
1034745110 7:153517144-153517166 TCAGTGTCTTTTGCCTTAGGTGG - Intergenic
1035586378 8:778555-778577 TGAGGGTCCTGTCCGTTAGGAGG - Intergenic
1035639408 8:1173090-1173112 TGAGGGTCCTGTCTCTTAGAAGG - Intergenic
1038226144 8:25660133-25660155 TGAGGGTCCTGTCCATTAGAAGG - Intergenic
1040604765 8:48920848-48920870 TAAGTCTCCTTTCCTTTAGAAGG - Intronic
1041946307 8:63447225-63447247 AAAGTGTCCTCTCTTTTAGGAGG + Intergenic
1042486918 8:69356601-69356623 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1043218767 8:77631149-77631171 TAAGATTCCTATCCCTTATGAGG + Intergenic
1044411832 8:91892131-91892153 TGAGGGTCCTGTCTGTTAGGAGG + Intergenic
1044746304 8:95374917-95374939 TGAGGGTCCTGTCCATTAGAAGG - Intergenic
1045725494 8:105168502-105168524 TAAGTCTCCTGTGCATTAGAGGG - Intronic
1046243529 8:111529848-111529870 TAACTCTCTTGTCCCCTAGGAGG + Intergenic
1048572844 8:135669404-135669426 TAAGTGACCTGGCCCAGAGGTGG - Intergenic
1050486210 9:6136640-6136662 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
1057294453 9:93827207-93827229 CAAAGCTCCTGTCCCTTAGGGGG - Intergenic
1057443611 9:95098866-95098888 TAAGGGTCCTGTCACCAAGGAGG - Intergenic
1057638948 9:96797927-96797949 TGAGGGTCCTGTCTCTTAGAAGG + Intergenic
1057682851 9:97206075-97206097 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
1057844205 9:98509201-98509223 TGAGGGTCCTGTCCGTTAGAAGG + Intronic
1058634198 9:107020416-107020438 TCTGTGTCCTGTCCCTGACGGGG + Intergenic
1060349177 9:122842686-122842708 TAAGTTTCCTCTCCCTTACCTGG + Intergenic
1061733340 9:132634460-132634482 TCAGTGTCCTTTTACTTAGGAGG - Intronic
1186033540 X:5395646-5395668 TTCGTGTCCTGTCTGTTAGGTGG - Intergenic
1187816643 X:23239311-23239333 TGAGGGTCCTGTCTCTTAGAAGG + Intergenic
1190118023 X:47638371-47638393 CAAGTCCCCTGTCCCATAGGAGG - Intronic
1191935944 X:66427049-66427071 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
1192041918 X:67631848-67631870 TGAGGGTCCTGTCTCTTAGAAGG - Intronic
1192372265 X:70524273-70524295 GAAGTGTCCAGTCCATTAGCAGG + Intergenic
1192599010 X:72441469-72441491 TGAGGGTCCTGTCTGTTAGGAGG + Intronic
1192692789 X:73381778-73381800 TGAGGGTCCTGTCCGTTAGAAGG + Intergenic
1192773578 X:74218570-74218592 TAAGTGTCCTAGCACTTAGCAGG - Intergenic
1193785608 X:85756921-85756943 TGAGTGTCCTGTCTGTTAGAAGG - Intergenic
1197814248 X:130480367-130480389 TGAGCGTCCTGCCCCTGAGGTGG - Intergenic
1197841947 X:130757610-130757632 TAAGTGTCCTGTCCCTTAGGTGG + Intronic
1198976258 X:142338918-142338940 TGAGGGTCCTGTCTCTTAGAAGG + Intergenic
1198980564 X:142390806-142390828 TGAGTGTCCTGTCTGTTAGAAGG - Intergenic
1199495150 X:148444495-148444517 ACAGAGTCCTGTCCCTTTGGAGG + Intergenic
1199800480 X:151246591-151246613 TAAGCATCCTGGCTCTTAGGTGG - Intergenic
1200408542 Y:2839400-2839422 TAATTGTCCTGTCCAGAAGGGGG - Intergenic
1200589010 Y:5046321-5046343 TGAGGGTCCTGTCTGTTAGGAGG - Intronic
1200722887 Y:6627579-6627601 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic
1201244848 Y:11993664-11993686 TGAGTGTCCTGTCTGTTAGAAGG - Intergenic
1201739922 Y:17312556-17312578 TGAGTGTCCTGTCTGTTAGAAGG + Intergenic
1201788006 Y:17806908-17806930 TAAGGGTCCTGTCTGTTAGAAGG - Intergenic
1201813547 Y:18099080-18099102 TAAGGGTCCTGTCTGTTAGAAGG + Intergenic